Rmu_co8260729.1_g000001

Brca1-associated

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8260729.1
N/A
Physical Location & Seq
Reverse (-)
376 .. 658
283 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8260729.1_g000001.1.cds

Sequence Viewer

Length: 201 bp
atgaggttaagagacgagaagatagttgatctggaagaacagatcagagatcttactgtctatattggagcccaaaaaacactgaatgacatgacgaactccgatgatatcaaagggggatcactcctacctgtaccgtcaaagcaatcttcttcggccaaaaatagaagacaaacaaaatctagcagaagacggaattag

Protein Analysis

66

Amino Acids

7.55

Weight (kDa)

10.1

Isoelectric Point (pI)

73.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 127
AcoI YGGCCR 1 cut(s) 156
AfaI GTAC 1 cut(s) 135
Alw26I GTCTC 1 cut(s) 6
AlwI GGATC 1 cut(s) 127
AoxI GGCC 1 cut(s) 156
BanII GRGCYC 1 cut(s) 73
BbsI GAAGAC 2 cut(s) 175, 196
BcoDI GTCTC 1 cut(s) 6
BfaI CTAG 1 cut(s) 183
BglII AGATCT 1 cut(s) 49
BmiI GGNNCC 1 cut(s) 70
BpiI GAAGAC 2 cut(s) 175, 196
BshFI GGCC 1 cut(s) 158
BsmAI GTCTC 1 cut(s) 6
BsmBI CGTCTC 1 cut(s) 6
BsnI GGCC 1 cut(s) 158
Bsp1286I GDGCHC 1 cut(s) 73
Bsp143I GATC 4 cut(s) 28, 42, 49, 119
BspANI GGCC 1 cut(s) 158
BspLI GGNNCC 1 cut(s) 70
BspPI GGATC 1 cut(s) 127
BssMI GATC 4 cut(s) 28, 42, 49, 119
Bst4CI ACNGT 2 cut(s) 58, 138
BstKTI GATC 4 cut(s) 31, 45, 52, 122
BstMAI GTCTC 1 cut(s) 6
BstMBI GATC 4 cut(s) 28, 42, 49, 119
BstV2I GAAGAC 2 cut(s) 175, 196
BstX2I RGATCY 1 cut(s) 49
BstYI RGATCY 1 cut(s) 49
BsuRI GGCC 1 cut(s) 158
BtsIMutI CAGTG 1 cut(s) 80
Csp6I GTAC 1 cut(s) 134
CviAII CATG 1 cut(s) 91
CviJI RGCY 2 cut(s) 71, 158
CviKI_1 RGCY 2 cut(s) 71, 158
CviQI GTAC 1 cut(s) 134
DpnI GATC 4 cut(s) 30, 44, 51, 121
DpnII GATC 4 cut(s) 28, 42, 49, 119
EaeI YGGCCR 1 cut(s) 156
Eco24I GRGCYC 1 cut(s) 73
Eco32I GATATC 1 cut(s) 109
EcoRV GATATC 1 cut(s) 109
EcoT38I GRGCYC 1 cut(s) 73
Esp3I CGTCTC 1 cut(s) 6
FaeI CATG 1 cut(s) 94
FaiI YATR 2 cut(s) 63, 92
FatI CATG 1 cut(s) 90
FriOI GRGCYC 1 cut(s) 73
FspBI CTAG 1 cut(s) 183
HaeIII GGCC 1 cut(s) 158
Hin1II CATG 1 cut(s) 94
Hpy188I TCNGA 2 cut(s) 47, 103
Hpy188III TCNNGA 1 cut(s) 32
HpyCH4III ACNGT 2 cut(s) 58, 138
Hsp92II CATG 1 cut(s) 94
Kzo9I GATC 4 cut(s) 28, 42, 49, 119
LmnI GCTCC 1 cut(s) 68
LpnPI CCDG 2 cut(s) 17, 144
MaeI CTAG 1 cut(s) 183
MalI GATC 4 cut(s) 30, 44, 51, 121
MboI GATC 4 cut(s) 28, 42, 49, 119
MboII GAAGA 6 cut(s) 31, 47, 141, 144, 180, 201
MflI RGATCY 1 cut(s) 49
MhlI GDGCHC 1 cut(s) 73
MluCI AATT 1 cut(s) 196
MseI TTAA 1 cut(s) 8
NdeII GATC 4 cut(s) 28, 42, 49, 119
NlaIII CATG 1 cut(s) 94
NlaIV GGNNCC 1 cut(s) 70
PspN4I GGNNCC 1 cut(s) 70
PsuI RGATCY 1 cut(s) 49
RsaI GTAC 1 cut(s) 135
RsaNI GTAC 1 cut(s) 134
SaqAI TTAA 1 cut(s) 8
Sau3AI GATC 4 cut(s) 28, 42, 49, 119
SduI GDGCHC 1 cut(s) 73
SetI ASST 2 cut(s) 8, 133
SgeI CNNG 5 cut(s) 28, 44, 103, 143, 195
Sse9I AATT 1 cut(s) 196
SspMI CTAG 1 cut(s) 183
TaaI ACNGT 2 cut(s) 58, 138
TasI AATT 1 cut(s) 196
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
TscAI CASTG 1 cut(s) 87
TspRI CASTG 1 cut(s) 87
XspI CTAG 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.