Rmu_co8269865.1_g000001

TMV resistance protein N-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8269865.1
N/A
Physical Location & Seq
Reverse (-)
1 .. 778
778 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8269865.1_g000001.1.cds

Sequence Viewer

Length: 597 bp
atgtctgcacttagaatcagttttgatggattgcatgagaaggagcagcaaatatttttagatattgcatgtttcttcaaaggacaggagagagatgaggtgacaatattgttggagggttttggttttgacccaatcattggtataagtaatctcattcgaaaatccctcatcagtatggtagggagtaaattgtggatgcatgatttgcttcaggaaatgggttgggaacttgttcgtggggaatctctcaatgaacctgggaatcgtagtagattatggcaacccgatgatgtgcttgatttactgaagtatcataagggatcagatgcagttcaagggatagtccttaccttgcctcaagaacagaaggagcaattgaaatgtgatgccttgtcaaacatgaaaaaattgagatttcttaaaatgtctaatgtgctccttccgttgggcctcaattatctatctactgagttaagagttctcgaatggcatggatatccttcaaagttgttgccaacagatttcccatcggagaagcttgttcaactcaacctgtttggcagccatatcaaacatctatggaagggattcaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

199

Amino Acids

22.91

Weight (kDa)

6.6

Isoelectric Point (pI)

49.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 140
AclWI GGATC 1 cut(s) 331
AcuI CTGAAG 2 cut(s) 197, 329
AfiI CCNNNNNNNGG 2 cut(s) 140, 448
AgsI TTSAA 6 cut(s) 79, 338, 382, 507, 548, 595
AjnI CCWGG 1 cut(s) 259
AluBI AGCT 1 cut(s) 541
AluI AGCT 1 cut(s) 541
Alw21I GWGCWC 1 cut(s) 441
AlwI GGATC 1 cut(s) 331
AoxI GGCC 1 cut(s) 451
ApeKI GCWGC 2 cut(s) 46, 564
Asp700I GAANNNNTTC 2 cut(s) 234, 590
AspS9I GGNCC 1 cut(s) 451
AsuHPI GGTGA 1 cut(s) 112
AsuII TTCGAA 1 cut(s) 160
BaeI ACNNNNGTAYC 2 cut(s) 296, 329
Bbv12I GWGCWC 1 cut(s) 441
BbvI GCAGC 2 cut(s) 58, 576
BccI CCATC 2 cut(s) 20, 538
BciT130I CCWGG 1 cut(s) 261
BisI GCNGC 2 cut(s) 47, 565
BlsI GCNGC 2 cut(s) 48, 566
Bme1390I CCNGG 1 cut(s) 261
BmgT120I GGNCC 1 cut(s) 451
BmrFI CCNGG 1 cut(s) 261
BmsI GCATC 3 cut(s) 189, 319, 379
Bpu14I TTCGAA 1 cut(s) 160
BpuEI CTTGAG 1 cut(s) 345
BsaJI CCNNGG 1 cut(s) 260
Bsc4I CCNNNNNNNGG 2 cut(s) 140, 448
BseBI CCWGG 1 cut(s) 261
BseDI CCNNGG 1 cut(s) 260
BseGI GGATG 1 cut(s) 204
BseLI CCNNNNNNNGG 2 cut(s) 140, 448
BseMII CTCAG 1 cut(s) 462
BseXI GCAGC 2 cut(s) 58, 576
BshFI GGCC 1 cut(s) 453
BsiHKAI GWGCWC 1 cut(s) 441
BslI CCNNNNNNNGG 2 cut(s) 140, 448
BsnI GGCC 1 cut(s) 453
Bsp119I TTCGAA 1 cut(s) 160
Bsp1286I GDGCHC 1 cut(s) 441
Bsp143I GATC 1 cut(s) 323
BspANI GGCC 1 cut(s) 453
BspCNI CTCAG 1 cut(s) 463
BspPI GGATC 1 cut(s) 331
BspT104I TTCGAA 1 cut(s) 160
BssECI CCNNGG 1 cut(s) 260
BssMI GATC 1 cut(s) 323
Bst2UI CCWGG 1 cut(s) 261
BstAPI GCANNNNNTGC 1 cut(s) 208
BstBI TTCGAA 1 cut(s) 160
BstDEI CTNAG 2 cut(s) 11, 471
BstF5I GGATG 1 cut(s) 204
BstKTI GATC 1 cut(s) 326
BstMBI GATC 1 cut(s) 323
BstMWI GCNNNNNNNGC 1 cut(s) 208
BstNI CCWGG 1 cut(s) 261
BstNSI RCATGY 1 cut(s) 72
BstSCI CCNGG 1 cut(s) 259
BstV1I GCAGC 2 cut(s) 58, 576
BsuRI GGCC 1 cut(s) 453
BtsCI GGATG 1 cut(s) 204
Cfr13I GGNCC 1 cut(s) 451
CviAII CATG 5 cut(s) 35, 69, 203, 403, 494
CviJI RGCY 3 cut(s) 453, 541, 567
CviKI_1 RGCY 3 cut(s) 453, 541, 567
DdeI CTNAG 2 cut(s) 11, 471
DpnI GATC 1 cut(s) 325
DpnII GATC 1 cut(s) 323
Eco32I GATATC 1 cut(s) 500
Eco57I CTGAAG 2 cut(s) 197, 329
EcoRII CCWGG 1 cut(s) 259
EcoRV GATATC 1 cut(s) 500
EcoT22I ATGCAT 1 cut(s) 204
FaeI CATG 5 cut(s) 38, 72, 206, 406, 497
FatI CATG 5 cut(s) 34, 68, 202, 402, 493
Fnu4HI GCNGC 2 cut(s) 47, 565
FokI GGATG 1 cut(s) 211
Fsp4HI GCNGC 2 cut(s) 47, 565
GluI GCNGC 2 cut(s) 47, 565
HaeIII GGCC 1 cut(s) 453
Hin1II CATG 5 cut(s) 38, 72, 206, 406, 497
HindIII AAGCTT 1 cut(s) 539
HinfI GANTC 4 cut(s) 15, 245, 265, 591
HphI GGTGA 1 cut(s) 112
Hpy188I TCNGA 2 cut(s) 328, 535
Hpy188III TCNNGA 3 cut(s) 215, 362, 485
HpyAV CCTTC 5 cut(s) 34, 364, 452, 513, 580
HpyCH4V TGCA 5 cut(s) 8, 34, 68, 202, 332
HpyF10VI GCNNNNNNNGC 1 cut(s) 208
HpyF3I CTNAG 2 cut(s) 11, 471
Hsp92II CATG 5 cut(s) 38, 72, 206, 406, 497
Kzo9I GATC 1 cut(s) 323
LmnI GCTCC 3 cut(s) 43, 373, 444
LpnPI CCDG 5 cut(s) 71, 200, 246, 273, 569
Lsp1109I GCAGC 2 cut(s) 58, 576
LweI GCATC 3 cut(s) 189, 319, 379
MaeIII GTNAC 1 cut(s) 100
MalI GATC 1 cut(s) 325
MboI GATC 1 cut(s) 323
MboII GAAGA 1 cut(s) 67
MfeI CAATTG 1 cut(s) 377
MhlI GDGCHC 1 cut(s) 441
MluCI AATT 4 cut(s) 191, 377, 410, 457
MmeI TCCRAC 1 cut(s) 93
MnlI CCTC 5 cut(s) 91, 109, 179, 369, 464
Mph1103I ATGCAT 1 cut(s) 204
MroXI GAANNNNTTC 2 cut(s) 234, 590
MseI TTAA 2 cut(s) 423, 476
MslI CAYNNNNRTG 1 cut(s) 176
MspR9I CCNGG 1 cut(s) 261
MunI CAATTG 1 cut(s) 377
MvaI CCWGG 1 cut(s) 261
MwoI GCNNNNNNNGC 1 cut(s) 208
NdeII GATC 1 cut(s) 323
NlaIII CATG 5 cut(s) 38, 72, 206, 406, 497
NmuCI GTSAC 1 cut(s) 100
NsiI ATGCAT 1 cut(s) 204
NspI RCATGY 1 cut(s) 72
NspV TTCGAA 1 cut(s) 160
PdmI GAANNNNTTC 2 cut(s) 234, 590
PfeI GAWTC 4 cut(s) 15, 245, 265, 591
PflMI CCANNNNNTGG 1 cut(s) 140
PkrI GCNGC 2 cut(s) 48, 566
Psp6I CCWGG 1 cut(s) 259
PspGI CCWGG 1 cut(s) 259
PspPI GGNCC 1 cut(s) 451
RseI CAYNNNNRTG 1 cut(s) 176
SaqAI TTAA 2 cut(s) 423, 476
SatI GCNGC 2 cut(s) 47, 565
Sau3AI GATC 1 cut(s) 323
Sau96I GGNCC 1 cut(s) 451
ScrFI CCNGG 1 cut(s) 261
SduI GDGCHC 1 cut(s) 441
SetI ASST 5 cut(s) 102, 262, 356, 543, 558
SfaNI GCATC 3 cut(s) 189, 319, 379
SfuI TTCGAA 1 cut(s) 160
SmiMI CAYNNNNRTG 1 cut(s) 176
SmlI CTYRAG 1 cut(s) 360
SmoI CTYRAG 1 cut(s) 360
Sse9I AATT 4 cut(s) 191, 377, 410, 457
SspI AATATT 2 cut(s) 54, 108
StyD4I CCNGG 1 cut(s) 259
TaqI TCGA 2 cut(s) 160, 486
TasI AATT 4 cut(s) 191, 377, 410, 457
TfiI GAWTC 4 cut(s) 15, 245, 265, 591
Tru1I TTAA 2 cut(s) 423, 476
Tru9I TTAA 2 cut(s) 423, 476
TseFI GTSAC 1 cut(s) 100
TseI GCWGC 2 cut(s) 46, 564
Tsp45I GTSAC 1 cut(s) 100
TspDTI ATGAA 2 cut(s) 270, 419
TspGWI ACGGA 1 cut(s) 435
Van91I CCANNNNNTGG 1 cut(s) 140
XceI RCATGY 1 cut(s) 72
XmnI GAANNNNTTC 2 cut(s) 234, 590
Zsp2I ATGCAT 1 cut(s) 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.