Rmu_co8273131.1_g000001

Receptor-like cytosolic serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8273131.1
N/A
Physical Location & Seq
Reverse (-)
2 .. 713
712 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8273131.1_g000001.1.cds

Sequence Viewer

Length: 299 bp
ctgtctgaagattatgaggctcagatatctgatttcggactagcaaagtggctccccgaaaaatggactcatcatgtagtattccctattgaaggcacattcggatatttgtctccagagtactttatgcatggaatcgtcgacgagaagactgatgtatttgcatatggagttttattactggagatcataacaggtcgtcgtgcagttgataacactcaacaaagccttgtgatatgggcaaaaccacttctggattcgggcaatgtcaaggaactagcagatcctcgattagaaga

Protein Analysis

99

Amino Acids

11.28

Weight (kDa)

4.69

Isoelectric Point (pI)

35.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 141
AclWI GGATC 1 cut(s) 278
AcuI CTGAAG 1 cut(s) 27
AfaI GTAC 1 cut(s) 122
AfiI CCNNNNNNNGG 2 cut(s) 63, 92
AgsI TTSAA 1 cut(s) 92
Alw26I GTCTC 1 cut(s) 117
AlwI GGATC 1 cut(s) 278
BbsI GAAGAC 1 cut(s) 155
BcoDI GTCTC 1 cut(s) 117
BfaI CTAG 2 cut(s) 41, 278
BmcAI AGTACT 1 cut(s) 122
BmiI GGNNCC 1 cut(s) 53
BpiI GAAGAC 1 cut(s) 155
BpmI CTGGAG 2 cut(s) 99, 203
Bsc4I CCNNNNNNNGG 2 cut(s) 63, 92
Bse1I ACTGG 1 cut(s) 186
Bse3DI GCAATG 1 cut(s) 271
BseLI CCNNNNNNNGG 2 cut(s) 63, 92
BseMI GCAATG 1 cut(s) 271
BseMII CTCAG 1 cut(s) 35
BseNI ACTGG 1 cut(s) 186
BsgI GTGCAG 1 cut(s) 225
BslI CCNNNNNNNGG 2 cut(s) 63, 92
BsmAI GTCTC 1 cut(s) 117
Bsp143I GATC 2 cut(s) 186, 283
BspCNI CTCAG 1 cut(s) 34
BspLI GGNNCC 1 cut(s) 53
BspPI GGATC 1 cut(s) 278
BsrDI GCAATG 1 cut(s) 271
BsrI ACTGG 1 cut(s) 186
BssMI GATC 2 cut(s) 186, 283
BstDEI CTNAG 1 cut(s) 21
BstENI CCTNNNNNAGG 1 cut(s) 90
BstKTI GATC 2 cut(s) 189, 286
BstMAI GTCTC 1 cut(s) 117
BstMBI GATC 2 cut(s) 186, 283
BstV2I GAAGAC 1 cut(s) 155
BstX2I RGATCY 1 cut(s) 283
BstYI RGATCY 1 cut(s) 283
Csp6I GTAC 1 cut(s) 121
CviAII CATG 2 cut(s) 74, 131
CviJI RGCY 3 cut(s) 20, 52, 228
CviKI_1 RGCY 3 cut(s) 20, 52, 228
CviQI GTAC 1 cut(s) 121
DdeI CTNAG 1 cut(s) 21
DpnI GATC 2 cut(s) 188, 285
DpnII GATC 2 cut(s) 186, 283
Eco32I GATATC 1 cut(s) 27
Eco57I CTGAAG 1 cut(s) 27
EcoNI CCTNNNNNAGG 1 cut(s) 90
EcoRV GATATC 1 cut(s) 27
EcoT22I ATGCAT 1 cut(s) 132
FaeI CATG 2 cut(s) 77, 134
FaiI YATR 8 cut(s) 15, 75, 128, 132, 166, 168, 191, 238
FatI CATG 2 cut(s) 73, 130
FauNDI CATATG 1 cut(s) 166
FblI GTMKAC 1 cut(s) 141
FspBI CTAG 2 cut(s) 41, 278
GsuI CTGGAG 2 cut(s) 99, 203
Hin1II CATG 2 cut(s) 77, 134
HincII GTYRAC 1 cut(s) 142
HindII GTYRAC 1 cut(s) 142
HinfI GANTC 3 cut(s) 67, 135, 257
Hpy166II GTNNAC 1 cut(s) 142
Hpy188I TCNGA 5 cut(s) 7, 24, 31, 38, 104
Hpy188III TCNNGA 2 cut(s) 116, 254
Hpy8I GTNNAC 1 cut(s) 142
Hpy99I CGWCG 3 cut(s) 143, 146, 204
HpyAV CCTTC 1 cut(s) 86
HpyCH4V TGCA 3 cut(s) 130, 164, 206
HpyF3I CTNAG 1 cut(s) 21
Hsp92II CATG 2 cut(s) 77, 134
Kzo9I GATC 2 cut(s) 186, 283
LmnI GCTCC 1 cut(s) 57
LpnPI CCDG 4 cut(s) 129, 167, 180, 239
MaeI CTAG 2 cut(s) 41, 278
MalI GATC 2 cut(s) 188, 285
MboI GATC 2 cut(s) 186, 283
MboII GAAGA 2 cut(s) 20, 160
MflI RGATCY 1 cut(s) 283
MlyI GAGTC 1 cut(s) 61
MnlI CCTC 2 cut(s) 10, 297
Mph1103I ATGCAT 1 cut(s) 132
NdeI CATATG 1 cut(s) 166
NdeII GATC 2 cut(s) 186, 283
NlaIII CATG 2 cut(s) 77, 134
NlaIV GGNNCC 1 cut(s) 53
NsiI ATGCAT 1 cut(s) 132
PfeI GAWTC 2 cut(s) 135, 257
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
PspN4I GGNNCC 1 cut(s) 53
PsuI RGATCY 1 cut(s) 283
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
SalI GTCGAC 1 cut(s) 140
Sau3AI GATC 2 cut(s) 186, 283
ScaI AGTACT 1 cut(s) 122
SchI GAGTC 1 cut(s) 61
SetI ASST 1 cut(s) 199
SgrDI CGTCGACG 1 cut(s) 140
SspMI CTAG 2 cut(s) 41, 278
TaqI TCGA 2 cut(s) 141, 289
TatI WGTACW 1 cut(s) 120
TfiI GAWTC 2 cut(s) 135, 257
XagI CCTNNNNNAGG 1 cut(s) 90
XmiI GTMKAC 1 cut(s) 141
XspI CTAG 2 cut(s) 41, 278
ZrmI AGTACT 1 cut(s) 122
Zsp2I ATGCAT 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.