Rmu_co8276821.1_g000001

Di-glucose binding within endoplasmic reticulum

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8276821.1
N/A
Physical Location & Seq
Reverse (-)
1 .. 766
766 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8276821.1_g000001.1.cds

Sequence Viewer

Length: 155 bp
atgcaatacttgagccttggcattaatgctttatcgggcgagctaccaaaggaactcggaaatctcactgaattgctatcatttgctattgggacaaacaacttttctggtcctctgccatctgaactaggcagtttatcaaaattacaacaact
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

5.51

Weight (kDa)

4.49

Isoelectric Point (pI)

21.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 43
AluI AGCT 1 cut(s) 43
AseI ATTAAT 1 cut(s) 24
AspS9I GGNCC 1 cut(s) 110
AvaII GGWCC 1 cut(s) 110
BccI CCATC 1 cut(s) 127
BfaI CTAG 1 cut(s) 128
Bme18I GGWCC 1 cut(s) 110
BmgT120I GGNCC 1 cut(s) 110
BpuEI CTTGAG 1 cut(s) 31
BsaJI CCNNGG 1 cut(s) 16
BseDI CCNNGG 1 cut(s) 16
BslFI GGGAC 1 cut(s) 106
BsmFI GGGAC 1 cut(s) 106
BssECI CCNNGG 1 cut(s) 16
BssT1I CCWWGG 1 cut(s) 16
BstC8I GCNNGC 1 cut(s) 41
BtsIMutI CAGTG 1 cut(s) 66
Cac8I GCNNGC 1 cut(s) 41
Cfr13I GGNCC 1 cut(s) 110
CviJI RGCY 2 cut(s) 15, 43
CviKI_1 RGCY 2 cut(s) 15, 43
Eco130I CCWWGG 1 cut(s) 16
Eco47I GGWCC 1 cut(s) 110
EcoT14I CCWWGG 1 cut(s) 16
ErhI CCWWGG 1 cut(s) 16
FaqI GGGAC 1 cut(s) 106
FspBI CTAG 1 cut(s) 128
Hpy188I TCNGA 2 cut(s) 59, 124
HpyCH4V TGCA 1 cut(s) 4
LpnPI CCDG 1 cut(s) 93
MaeI CTAG 1 cut(s) 128
MluCI AATT 2 cut(s) 71, 143
MnlI CCTC 1 cut(s) 123
MseI TTAA 1 cut(s) 24
PshBI ATTAAT 1 cut(s) 24
PspPI GGNCC 1 cut(s) 110
SaqAI TTAA 1 cut(s) 24
Sau96I GGNCC 1 cut(s) 110
SetI ASST 1 cut(s) 45
SgeI CNNG 7 cut(s) 22, 29, 48, 52, 68, 120, 140
SinI GGWCC 1 cut(s) 110
SmlI CTYRAG 1 cut(s) 10
SmoI CTYRAG 1 cut(s) 10
Sse9I AATT 2 cut(s) 71, 143
SspMI CTAG 1 cut(s) 128
StyI CCWWGG 1 cut(s) 16
TasI AATT 2 cut(s) 71, 143
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TscAI CASTG 1 cut(s) 73
TspRI CASTG 1 cut(s) 73
VpaK11BI GGWCC 1 cut(s) 110
VspI ATTAAT 1 cut(s) 24
XspI CTAG 1 cut(s) 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.