Rmu_co8287657.1_g000001

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8287657.1
N/A
Physical Location & Seq
Reverse (-)
2 .. 242
241 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8287657.1_g000001.1.cds

Sequence Viewer

Length: 241 bp
atgtccaacaatttcaagaacaagctgggtgaaggaggctatggctctgtatttaaaggagtgttacgtagtggtcgttttggagccatcaaggtgatggcaaattccaaatcaaatggacaagattttgtgagcgaagtggctacaattggaaggattcaccatgtcaatgtggtgcaacttattggttattgtgttgagggatcaaaacgtgctctagtctatgatttcatgcctaatg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

8.7

Weight (kDa)

9.73

Isoelectric Point (pI)

27.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 211
AcsI RAATTY 1 cut(s) 103
AgsI TTSAA 1 cut(s) 16
AluBI AGCT 1 cut(s) 25
AluI AGCT 1 cut(s) 25
Alw21I GWGCWC 1 cut(s) 217
AlwI GGATC 1 cut(s) 211
ApoI RAATTY 1 cut(s) 103
AsuHPI GGTGA 3 cut(s) 41, 106, 152
Bbv12I GWGCWC 1 cut(s) 217
BccI CCATC 2 cut(s) 91, 95
BfaI CTAG 1 cut(s) 218
BmiI GGNNCC 1 cut(s) 85
BsaAI YACGTR 1 cut(s) 68
BseYI CCCAGC 1 cut(s) 25
BsiHKAI GWGCWC 1 cut(s) 217
Bsp1286I GDGCHC 1 cut(s) 217
Bsp143I GATC 1 cut(s) 203
BspLI GGNNCC 1 cut(s) 85
BspPI GGATC 1 cut(s) 211
BssMI GATC 1 cut(s) 203
BstBAI YACGTR 1 cut(s) 68
BstKTI GATC 1 cut(s) 206
BstMBI GATC 1 cut(s) 203
BstSNI TACGTA 1 cut(s) 68
CviAII CATG 2 cut(s) 164, 232
CviJI RGCY 5 cut(s) 25, 39, 45, 86, 143
CviKI_1 RGCY 5 cut(s) 25, 39, 45, 86, 143
DpnI GATC 1 cut(s) 205
DpnII GATC 1 cut(s) 203
DraI TTTAAA 1 cut(s) 55
Eco105I TACGTA 1 cut(s) 68
FaeI CATG 2 cut(s) 167, 235
FaiI YATR 4 cut(s) 42, 165, 225, 233
FatI CATG 2 cut(s) 163, 231
FspBI CTAG 1 cut(s) 218
GsaI CCCAGC 1 cut(s) 29
Hin1II CATG 2 cut(s) 167, 235
HinfI GANTC 1 cut(s) 157
HphI GGTGA 3 cut(s) 41, 106, 152
Hpy188III TCNNGA 1 cut(s) 16
HpyAV CCTTC 2 cut(s) 26, 147
HpyCH4IV ACGT 2 cut(s) 67, 211
HpyCH4V TGCA 1 cut(s) 178
HpySE526I ACGT 2 cut(s) 67, 211
Hsp92II CATG 2 cut(s) 167, 235
Kzo9I GATC 1 cut(s) 203
LmnI GCTCC 1 cut(s) 83
LpnPI CCDG 1 cut(s) 11
MaeI CTAG 1 cut(s) 218
MaeII ACGT 2 cut(s) 67, 211
MaeIII GTNAC 1 cut(s) 63
MalI GATC 1 cut(s) 205
MboI GATC 1 cut(s) 203
MfeI CAATTG 1 cut(s) 147
MhlI GDGCHC 1 cut(s) 217
MluCI AATT 3 cut(s) 10, 103, 147
MmeI TCCRAC 1 cut(s) 30
MnlI CCTC 2 cut(s) 29, 193
MseI TTAA 1 cut(s) 54
MslI CAYNNNNRTG 2 cut(s) 92, 168
MunI CAATTG 1 cut(s) 147
NdeII GATC 1 cut(s) 203
NlaIII CATG 2 cut(s) 167, 235
NlaIV GGNNCC 1 cut(s) 85
PcsI WCGNNNNNNNCGW 1 cut(s) 73
PfeI GAWTC 1 cut(s) 157
Ppu21I YACGTR 1 cut(s) 68
PspFI CCCAGC 1 cut(s) 25
PspN4I GGNNCC 1 cut(s) 85
RseI CAYNNNNRTG 2 cut(s) 92, 168
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 1 cut(s) 203
SduI GDGCHC 1 cut(s) 217
SetI ASST 4 cut(s) 27, 70, 96, 214
SgeI CNNG 8 cut(s) 28, 34, 38, 103, 134, 176, 224, 230
SmiMI CAYNNNNRTG 2 cut(s) 92, 168
SnaBI TACGTA 1 cut(s) 68
Sse9I AATT 3 cut(s) 10, 103, 147
SspMI CTAG 1 cut(s) 218
TaiI ACGT 2 cut(s) 70, 214
TasI AATT 3 cut(s) 10, 103, 147
TfiI GAWTC 1 cut(s) 157
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TspDTI ATGAA 1 cut(s) 220
XapI RAATTY 1 cut(s) 103
XcmI CCANNNNNNNNNTGG 1 cut(s) 94
XspI CTAG 1 cut(s) 218
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.