Rmu_co8298471.1_g000001

Casein kinase II subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8298471.1
N/A
Physical Location & Seq
Forward (+)
1 .. 223
223 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8298471.1_g000001.1.cds

Sequence Viewer

Length: 162 bp
gcattggattactgtcattcccagggcataatgcatcgagatgtgaagcctcacaacgttatgattgatcacgagttgcggaaacttcgcctgattgattggggtcttgctgaattctaccatcctggcaaagaatacaatgtccgagtagcttcaaggtag

Protein Analysis

53

Amino Acids

6.32

Weight (kDa)

8.2

Isoelectric Point (pI)

44.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 79
AclI AACGTT 1 cut(s) 57
AcsI RAATTY 1 cut(s) 113
AgsI TTSAA 1 cut(s) 156
AjnI CCWGG 2 cut(s) 21, 124
AluBI AGCT 1 cut(s) 152
AluI AGCT 1 cut(s) 152
ApoI RAATTY 1 cut(s) 113
BauI CACGAG 1 cut(s) 71
BccI CCATC 1 cut(s) 129
BciT130I CCWGG 2 cut(s) 23, 126
BclI TGATCA 1 cut(s) 67
Bme1390I CCNGG 2 cut(s) 23, 126
BmrFI CCNGG 2 cut(s) 23, 126
BmsI GCATC 1 cut(s) 43
BsaJI CCNNGG 2 cut(s) 21, 22
BseBI CCWGG 2 cut(s) 23, 126
BseDI CCNNGG 2 cut(s) 21, 22
BseGI GGATG 1 cut(s) 121
Bsp143I GATC 1 cut(s) 67
BspACI CCGC 1 cut(s) 79
BssECI CCNNGG 2 cut(s) 21, 22
BssMI GATC 1 cut(s) 67
BssSI CACGAG 1 cut(s) 71
Bst2BI CACGAG 1 cut(s) 71
Bst2UI CCWGG 2 cut(s) 23, 126
Bst4CI ACNGT 1 cut(s) 14
BstF5I GGATG 1 cut(s) 121
BstKTI GATC 1 cut(s) 70
BstMBI GATC 1 cut(s) 67
BstNI CCWGG 2 cut(s) 23, 126
BstSCI CCNGG 2 cut(s) 21, 124
BtsCI GGATG 1 cut(s) 121
CviJI RGCY 2 cut(s) 49, 152
CviKI_1 RGCY 2 cut(s) 49, 152
DpnI GATC 1 cut(s) 69
DpnII GATC 1 cut(s) 67
EcoRI GAATTC 1 cut(s) 113
EcoRII CCWGG 2 cut(s) 21, 124
EcoT22I ATGCAT 1 cut(s) 36
FaiI YATR 2 cut(s) 29, 62
FbaI TGATCA 1 cut(s) 67
FokI GGATG 1 cut(s) 108
Hpy188I TCNGA 1 cut(s) 146
Hpy188III TCNNGA 2 cut(s) 38, 71
HpyCH4III ACNGT 1 cut(s) 14
HpyCH4IV ACGT 1 cut(s) 57
HpyCH4V TGCA 1 cut(s) 34
HpySE526I ACGT 1 cut(s) 57
Ksp22I TGATCA 1 cut(s) 67
Kzo9I GATC 1 cut(s) 67
LpnPI CCDG 5 cut(s) 8, 35, 104, 111, 138
LweI GCATC 1 cut(s) 43
MaeII ACGT 1 cut(s) 57
MalI GATC 1 cut(s) 69
MboI GATC 1 cut(s) 67
MluCI AATT 1 cut(s) 113
MnlI CCTC 1 cut(s) 60
Mph1103I ATGCAT 1 cut(s) 36
MslI CAYNNNNRTG 1 cut(s) 39
MspR9I CCNGG 2 cut(s) 23, 126
MvaI CCWGG 2 cut(s) 23, 126
NdeII GATC 1 cut(s) 67
NsiI ATGCAT 1 cut(s) 36
PasI CCCWGGG 1 cut(s) 22
Psp1406I AACGTT 1 cut(s) 57
Psp6I CCWGG 2 cut(s) 21, 124
PspGI CCWGG 2 cut(s) 21, 124
RseI CAYNNNNRTG 1 cut(s) 39
Sau3AI GATC 1 cut(s) 67
ScrFI CCNGG 2 cut(s) 23, 126
SetI ASST 3 cut(s) 60, 154, 161
SfaNI GCATC 1 cut(s) 43
SmiMI CAYNNNNRTG 1 cut(s) 39
Sse9I AATT 1 cut(s) 113
SsiI CCGC 1 cut(s) 79
StyD4I CCNGG 2 cut(s) 21, 124
TaaI ACNGT 1 cut(s) 14
TaiI ACGT 1 cut(s) 60
TaqI TCGA 1 cut(s) 37
TasI AATT 1 cut(s) 113
XapI RAATTY 1 cut(s) 113
Zsp2I ATGCAT 1 cut(s) 36
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.