Rmu_co8305987.1_g000001

Protein prenyltransferase alpha subunit repeat

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8305987.1
N/A
Physical Location & Seq
Forward (+)
1 .. 405
405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8305987.1_g000001.1.cds

Sequence Viewer

Length: 257 bp
agactattgctaatgaaattgctattttccgagagttgttgtcagagacaagctgtaaaattggaaaacttacgttggcaagattactaacagcttatgatgttattcagtctcaatgtgcaaacaaaatggtcaattctgaagaagttctggagctttatgctgacctactaaagttggacccgacacattgtcagtattacaaagatgagcacagcttagttttcttgcagcaggtaattttcttttcttcatga

Protein Analysis

84

Amino Acids

9.62

Weight (kDa)

4.95

Isoelectric Point (pI)

43.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 225
AcuI CTGAAG 1 cut(s) 161
AhdI GACNNNNNGTC 1 cut(s) 191
AluBI AGCT 4 cut(s) 53, 94, 156, 218
AluI AGCT 4 cut(s) 53, 94, 156, 218
Alw21I GWGCWC 1 cut(s) 215
Alw26I GTCTC 2 cut(s) 40, 116
ApeKI GCWGC 1 cut(s) 231
Asp700I GAANNNNTTC 1 cut(s) 146
AspS9I GGNCC 1 cut(s) 180
AvaII GGWCC 1 cut(s) 180
Bbv12I GWGCWC 1 cut(s) 215
BbvI GCAGC 1 cut(s) 243
BcoDI GTCTC 2 cut(s) 40, 116
BfuAI ACCTGC 1 cut(s) 225
BisI GCNGC 1 cut(s) 232
BlsI GCNGC 1 cut(s) 233
Bme18I GGWCC 1 cut(s) 180
BmeRI GACNNNNNGTC 1 cut(s) 191
BmgT120I GGNCC 1 cut(s) 180
BmiI GGNNCC 1 cut(s) 182
BpmI CTGGAG 1 cut(s) 172
BseXI GCAGC 1 cut(s) 243
BsiHKAI GWGCWC 1 cut(s) 215
BsmAI GTCTC 2 cut(s) 40, 116
Bsp1286I GDGCHC 1 cut(s) 215
BspHI TCATGA 1 cut(s) 253
BspLI GGNNCC 1 cut(s) 182
BspMI ACCTGC 1 cut(s) 225
BstDEI CTNAG 1 cut(s) 219
BstMAI GTCTC 2 cut(s) 40, 116
BstV1I GCAGC 1 cut(s) 243
BveI ACCTGC 1 cut(s) 225
CciI TCATGA 1 cut(s) 253
Cfr13I GGNCC 1 cut(s) 180
CviAII CATG 1 cut(s) 254
CviJI RGCY 4 cut(s) 53, 94, 156, 218
CviKI_1 RGCY 4 cut(s) 53, 94, 156, 218
DdeI CTNAG 1 cut(s) 219
DriI GACNNNNNGTC 1 cut(s) 191
Eam1105I GACNNNNNGTC 1 cut(s) 191
Eco47I GGWCC 1 cut(s) 180
Eco57I CTGAAG 1 cut(s) 161
FaeI CATG 1 cut(s) 257
FaiI YATR 3 cut(s) 98, 161, 255
FatI CATG 1 cut(s) 253
Fnu4HI GCNGC 1 cut(s) 232
Fsp4HI GCNGC 1 cut(s) 232
GluI GCNGC 1 cut(s) 232
GsuI CTGGAG 1 cut(s) 172
Hin1II CATG 1 cut(s) 257
Hpy188I TCNGA 3 cut(s) 31, 45, 141
Hpy188III TCNNGA 2 cut(s) 151, 254
HpyCH4IV ACGT 1 cut(s) 73
HpyCH4V TGCA 2 cut(s) 121, 231
HpyF3I CTNAG 1 cut(s) 219
HpySE526I ACGT 1 cut(s) 73
Hsp92II CATG 1 cut(s) 257
LmnI GCTCC 1 cut(s) 153
LpnPI CCDG 2 cut(s) 136, 220
Lsp1109I GCAGC 1 cut(s) 243
MaeII ACGT 1 cut(s) 73
MboII GAAGA 2 cut(s) 154, 242
MhlI GDGCHC 1 cut(s) 215
MluCI AATT 4 cut(s) 17, 59, 135, 239
MmeI TCCRAC 1 cut(s) 158
MroXI GAANNNNTTC 1 cut(s) 146
NlaIII CATG 1 cut(s) 257
NlaIV GGNNCC 1 cut(s) 182
PagI TCATGA 1 cut(s) 253
PdmI GAANNNNTTC 1 cut(s) 146
PkrI GCNGC 1 cut(s) 233
PspN4I GGNNCC 1 cut(s) 182
PspPI GGNCC 1 cut(s) 180
SatI GCNGC 1 cut(s) 232
Sau96I GGNCC 1 cut(s) 180
SduI GDGCHC 1 cut(s) 215
SetI ASST 7 cut(s) 55, 76, 96, 158, 170, 220, 239
SgeI CNNG 7 cut(s) 43, 62, 92, 163, 195, 240, 247
SinI GGWCC 1 cut(s) 180
Sse9I AATT 4 cut(s) 17, 59, 135, 239
TaiI ACGT 1 cut(s) 76
TasI AATT 4 cut(s) 17, 59, 135, 239
TseI GCWGC 1 cut(s) 231
TspDTI ATGAA 2 cut(s) 29, 242
VpaK11BI GGWCC 1 cut(s) 180
XmnI GAANNNNTTC 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.