Rmu_co8324287.1_g000001

ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8324287.1
N/A
Physical Location & Seq
Forward (+)
140 .. 956
817 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8324287.1_g000001.1.cds

Sequence Viewer

Length: 413 bp
atgggccaagatataatcaagcagttaaagggaatgaatgggcaggcagtaccagttggatatgggagtcctaacagtgatgctgggcacgtagtccttggatcatcaaaaaggtgcagttttcaagcacaggaaaagctatccagaccatttgtcagtttgggccaagatgtaacaaataggttaaagttcaagttaaagcgaatggaaatgcgatcacggggatatgagagtcccaaggatgatgctagacaggtagttcttgaagcatcaaggaggggcagttttcttcaagcaccggaaaagcatgctaaaacattggacggtacgggccaagatggacgtgcagtaccagttggattggacagtcccaagggtgatgctacacacccagtccttgaagcatcaaagag

Protein Analysis

137

Amino Acids

14.82

Weight (kDa)

9.76

Isoelectric Point (pI)

47.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 109
AfaI GTAC 3 cut(s) 51, 328, 351
AgsI TTSAA 5 cut(s) 125, 193, 266, 293, 401
AhdI GACNNNNNGTC 1 cut(s) 152
AjiI CACGTC 1 cut(s) 344
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
AlwI GGATC 1 cut(s) 109
AoxI GGCC 3 cut(s) 4, 163, 331
AspS9I GGNCC 3 cut(s) 4, 163, 331
AsuHPI GGTGA 1 cut(s) 389
BaeGI GKGCMC 1 cut(s) 90
BccI CCATC 1 cut(s) 332
BfaI CTAG 1 cut(s) 249
BmeRI GACNNNNNGTC 1 cut(s) 152
BmgBI CACGTC 1 cut(s) 344
BmgT120I GGNCC 3 cut(s) 4, 163, 331
BmrI ACTGGG 1 cut(s) 386
BmsI GCATC 4 cut(s) 70, 235, 278, 370
BmuI ACTGGG 1 cut(s) 386
BsaAI YACGTR 1 cut(s) 91
BsaJI CCNNGG 3 cut(s) 97, 237, 372
BsaWI WCCGGW 1 cut(s) 298
BsaXI ACNNNNNCTCC 2 cut(s) 268, 298
Bse1I ACTGG 3 cut(s) 53, 353, 392
BseDI CCNNGG 3 cut(s) 97, 237, 372
BseGI GGATG 1 cut(s) 247
BseNI ACTGG 3 cut(s) 53, 353, 392
BseSI GKGCMC 1 cut(s) 90
BseYI CCCAGC 1 cut(s) 83
BsgI GTGCAG 2 cut(s) 136, 366
BshFI GGCC 3 cut(s) 6, 165, 333
BsiSI CCGG 1 cut(s) 299
BslFI GGGAC 2 cut(s) 219, 354
BsmFI GGGAC 2 cut(s) 219, 354
BsnI GGCC 3 cut(s) 6, 165, 333
Bsp1286I GDGCHC 1 cut(s) 90
Bsp143I GATC 2 cut(s) 101, 215
BspANI GGCC 3 cut(s) 6, 165, 333
BspPI GGATC 1 cut(s) 109
BsrI ACTGG 3 cut(s) 53, 353, 392
BssECI CCNNGG 3 cut(s) 97, 237, 372
BssMI GATC 2 cut(s) 101, 215
BssT1I CCWWGG 3 cut(s) 97, 237, 372
Bst4CI ACNGT 3 cut(s) 77, 326, 368
BstBAI YACGTR 1 cut(s) 91
BstC8I GCNNGC 2 cut(s) 45, 309
BstF5I GGATG 1 cut(s) 247
BstKTI GATC 2 cut(s) 104, 218
BstMBI GATC 2 cut(s) 101, 215
BstNSI RCATGY 1 cut(s) 311
BstSLI GKGCMC 1 cut(s) 90
BsuRI GGCC 3 cut(s) 6, 165, 333
BtrI CACGTC 1 cut(s) 344
BtsCI GGATG 1 cut(s) 247
BtsIMutI CAGTG 1 cut(s) 82
Cac8I GCNNGC 2 cut(s) 45, 309
Cfr13I GGNCC 3 cut(s) 4, 163, 331
Csp6I GTAC 3 cut(s) 50, 327, 350
CviAII CATG 1 cut(s) 308
CviJI RGCY 4 cut(s) 6, 139, 165, 333
CviKI_1 RGCY 4 cut(s) 6, 139, 165, 333
CviQI GTAC 3 cut(s) 50, 327, 350
DpnI GATC 2 cut(s) 103, 217
DpnII GATC 2 cut(s) 101, 215
DriI GACNNNNNGTC 1 cut(s) 152
Eam1105I GACNNNNNGTC 1 cut(s) 152
Eco130I CCWWGG 3 cut(s) 97, 237, 372
EcoT14I CCWWGG 3 cut(s) 97, 237, 372
ErhI CCWWGG 3 cut(s) 97, 237, 372
FaeI CATG 1 cut(s) 311
FaiI YATR 4 cut(s) 14, 63, 228, 309
FaqI GGGAC 2 cut(s) 219, 354
FatI CATG 1 cut(s) 307
FokI GGATG 1 cut(s) 254
FspBI CTAG 1 cut(s) 249
GsaI CCCAGC 1 cut(s) 87
HaeIII GGCC 3 cut(s) 6, 165, 333
HapII CCGG 1 cut(s) 299
Hin1II CATG 1 cut(s) 311
HinfI GANTC 2 cut(s) 67, 232
HpaII CCGG 1 cut(s) 299
HphI GGTGA 1 cut(s) 389
Hpy188III TCNNGA 2 cut(s) 144, 263
HpyCH4III ACNGT 3 cut(s) 77, 326, 368
HpyCH4IV ACGT 2 cut(s) 90, 343
HpyCH4V TGCA 2 cut(s) 117, 347
HpySE526I ACGT 2 cut(s) 90, 343
Hsp92II CATG 1 cut(s) 311
Kzo9I GATC 2 cut(s) 101, 215
LpnPI CCDG 9 cut(s) 29, 66, 69, 116, 157, 239, 312, 366, 405
LweI GCATC 4 cut(s) 70, 235, 278, 370
MaeI CTAG 1 cut(s) 249
MaeII ACGT 2 cut(s) 90, 343
MaeIII GTNAC 1 cut(s) 172
MalI GATC 2 cut(s) 103, 217
MboI GATC 2 cut(s) 101, 215
MboII GAAGA 1 cut(s) 281
MhlI GDGCHC 1 cut(s) 90
MlyI GAGTC 2 cut(s) 76, 241
MmeI TCCRAC 2 cut(s) 37, 337
MnlI CCTC 1 cut(s) 270
MseI TTAA 3 cut(s) 26, 185, 197
MspI CCGG 1 cut(s) 299
NdeII GATC 2 cut(s) 101, 215
NlaIII CATG 1 cut(s) 311
NspI RCATGY 1 cut(s) 311
PaeI GCATGC 1 cut(s) 311
PleI GAGTC 2 cut(s) 75, 240
PpsI GAGTC 2 cut(s) 75, 240
Ppu21I YACGTR 1 cut(s) 91
PspFI CCCAGC 1 cut(s) 83
PspPI GGNCC 3 cut(s) 4, 163, 331
RsaI GTAC 3 cut(s) 51, 328, 351
RsaNI GTAC 3 cut(s) 50, 327, 350
SaqAI TTAA 3 cut(s) 26, 185, 197
Sau3AI GATC 2 cut(s) 101, 215
Sau96I GGNCC 3 cut(s) 4, 163, 331
SchI GAGTC 2 cut(s) 76, 241
SduI GDGCHC 1 cut(s) 90
SetI ASST 6 cut(s) 93, 116, 141, 185, 258, 346
SfaNI GCATC 4 cut(s) 70, 235, 278, 370
SphI GCATGC 1 cut(s) 311
SspMI CTAG 1 cut(s) 249
StyI CCWWGG 3 cut(s) 97, 237, 372
TaaI ACNGT 3 cut(s) 77, 326, 368
TaiI ACGT 2 cut(s) 93, 346
Tru1I TTAA 3 cut(s) 26, 185, 197
Tru9I TTAA 3 cut(s) 26, 185, 197
TscAI CASTG 1 cut(s) 82
TspDTI ATGAA 1 cut(s) 50
TspRI CASTG 1 cut(s) 82
XceI RCATGY 1 cut(s) 311
XspI CTAG 1 cut(s) 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.