Rmu_co8333891.1_g000001
BHLH Family

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8333891.1
N/A
Physical Location & Seq
Reverse (-)
2 .. 878
877 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8333891.1_g000001.1.cds

Sequence Viewer

Length: 877 bp
atgcttgggcaaggtatatgccctgatgttaccacatttaataagcttatacataccctgtccaagaagggggatgtccaagaaagcgaaaaacttctcaacaaggttctgaagaggggagtgtctccaaatttgtttacacttaatatattcattcaagggctgtgcaaaagaggttccattgatggggctgtcagaatgttagatggttttgtgaaggaaggtctgactccagatgttgtcacgtataatacattgatctttggtttgtgtaaaaacttcagggttgaggaagcagagtcctatctgcgtaaaatggtgaacaatggatttcagcctgatgcctttacctacaacagtattgttgatggatattgcaaattgggcatgatacagaaagcagaaaagattctcagtgacgccatcttcatggggtttgtgcctgatgagttcacgtattgctctttaattaaggggttttgccaggatggtgacatagaacgtgccatagcagtgtttaaggaggcattgggcaagggattaaagcttaatattgttctctttaacacattggtaaaagggttgtcacagaatgggcttatcttgcaagccttacaattaatgaatgagatgtcggaaaatggttgcagtcccaatatctggacttacaatttggttataaatgggttgtgcaagatgggttatgtttctgatgccactagacttgttgatgatgctattgccaaaggttaccttcctgacatatttacgtttaatacaataattgatggttactgtaaacagttgaatctgaataatgctatcgagataataaatagcatgtggagtcatggtgttactcctgatgtgatcacat

Protein Analysis

292

Amino Acids

32.38

Weight (kDa)

5.8

Isoelectric Point (pI)

27.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 680
AccB7I CCANNNNNTGG 1 cut(s) 660
AcsI RAATTY 1 cut(s) 130
AcuI CTGAAG 2 cut(s) 131, 265
AcyI GRCGYC 1 cut(s) 420
AfiI CCNNNNNNNGG 3 cut(s) 69, 186, 660
AgsI TTSAA 2 cut(s) 158, 808
AjnI CCWGG 1 cut(s) 483
AluBI AGCT 2 cut(s) 46, 547
AluI AGCT 2 cut(s) 46, 547
Alw26I GTCTC 1 cut(s) 129
ApoI RAATTY 1 cut(s) 130
ArsI GACNNNNNNTTYG 2 cut(s) 655, 687
AseI ATTAAT 1 cut(s) 620
Asp700I GAANNNNTTC 2 cut(s) 93, 408
AsuHPI GGTGA 2 cut(s) 331, 503
BccI CCATC 7 cut(s) 179, 200, 362, 431, 482, 691, 782
BciT130I CCWGG 1 cut(s) 485
BclI TGATCA 1 cut(s) 870
BcoDI GTCTC 1 cut(s) 129
BfaI CTAG 1 cut(s) 720
Bme1390I CCNGG 1 cut(s) 485
BmiI GGNNCC 1 cut(s) 178
BmrFI CCNGG 1 cut(s) 485
BmsI GCATC 3 cut(s) 331, 703, 724
BpmI CTGGAG 1 cut(s) 216
BsaAI YACGTR 2 cut(s) 246, 456
BsaHI GRCGYC 1 cut(s) 420
BsaXI ACNNNNNCTCC 2 cut(s) 838, 868
Bsc4I CCNNNNNNNGG 3 cut(s) 69, 186, 660
BseBI CCWGG 1 cut(s) 485
BseGI GGATG 2 cut(s) 79, 493
BseLI CCNNNNNNNGG 3 cut(s) 69, 186, 660
BseMII CTCAG 1 cut(s) 427
BslFI GGGAC 1 cut(s) 636
BslI CCNNNNNNNGG 3 cut(s) 69, 186, 660
BsmAI GTCTC 1 cut(s) 129
BsmFI GGGAC 1 cut(s) 636
Bsp143I GATC 2 cut(s) 258, 870
BspCNI CTCAG 1 cut(s) 426
BspLI GGNNCC 1 cut(s) 178
BssMI GATC 2 cut(s) 258, 870
BssNI GRCGYC 1 cut(s) 420
Bst2UI CCWGG 1 cut(s) 485
Bst4CI ACNGT 3 cut(s) 359, 797, 804
Bst6I CTCTTC 1 cut(s) 107
BstACI GRCGYC 1 cut(s) 420
BstBAI YACGTR 2 cut(s) 246, 456
BstC8I GCNNGC 1 cut(s) 609
BstDEI CTNAG 1 cut(s) 413
BstEII GGTNACC 1 cut(s) 749
BstF5I GGATG 2 cut(s) 79, 493
BstKTI GATC 2 cut(s) 261, 873
BstMAI GTCTC 1 cut(s) 129
BstMBI GATC 2 cut(s) 258, 870
BstMWI GCNNNNNNNGC 2 cut(s) 384, 604
BstNI CCWGG 1 cut(s) 485
BstNSI RCATGY 1 cut(s) 844
BstPI GGTNACC 1 cut(s) 749
BstSCI CCNGG 1 cut(s) 483
BstXI CCANNNNNNTGG 1 cut(s) 430
BtsCI GGATG 2 cut(s) 79, 493
BtsI GCAGTG 1 cut(s) 519
BtsIMutI CAGTG 2 cut(s) 421, 519
Cac8I GCNNGC 1 cut(s) 609
CseI GACGC 1 cut(s) 428
CspCI CAANNNNNGTGG 2 cut(s) 706, 741
CviAII CATG 4 cut(s) 388, 430, 841, 851
CviJI RGCY 7 cut(s) 46, 163, 191, 337, 547, 598, 611
CviKI_1 RGCY 7 cut(s) 46, 163, 191, 337, 547, 598, 611
DdeI CTNAG 1 cut(s) 413
DpnI GATC 2 cut(s) 260, 872
DpnII GATC 2 cut(s) 258, 870
Eam1104I CTCTTC 1 cut(s) 107
EarI CTCTTC 1 cut(s) 107
Eco57I CTGAAG 2 cut(s) 131, 265
Eco91I GGTNACC 1 cut(s) 749
EcoO65I GGTNACC 1 cut(s) 749
EcoRII CCWGG 1 cut(s) 483
FaeI CATG 4 cut(s) 391, 433, 844, 854
FalI AAGNNNNNCTT 2 cut(s) 738, 770
FaqI GGGAC 1 cut(s) 636
FatI CATG 4 cut(s) 387, 429, 840, 850
FbaI TGATCA 1 cut(s) 870
FokI GGATG 2 cut(s) 86, 500
FspBI CTAG 1 cut(s) 720
GsuI CTGGAG 1 cut(s) 216
HgaI GACGC 1 cut(s) 428
Hin1I GRCGYC 1 cut(s) 420
Hin1II CATG 4 cut(s) 391, 433, 844, 854
HindIII AAGCTT 2 cut(s) 44, 545
HinfI GANTC 5 cut(s) 229, 299, 409, 808, 847
HphI GGTGA 2 cut(s) 331, 503
Hpy166II GTNNAC 4 cut(s) 138, 322, 453, 800
Hpy188I TCNGA 6 cut(s) 111, 197, 228, 637, 712, 813
Hpy188III TCNNGA 5 cut(s) 233, 661, 758, 826, 863
Hpy8I GTNNAC 4 cut(s) 138, 322, 453, 800
HpyAV CCTTC 4 cut(s) 61, 211, 215, 764
HpyCH4III ACNGT 3 cut(s) 359, 797, 804
HpyCH4IV ACGT 4 cut(s) 245, 455, 502, 770
HpyCH4V TGCA 5 cut(s) 168, 378, 607, 648, 693
HpyF10VI GCNNNNNNNGC 2 cut(s) 384, 604
HpyF3I CTNAG 1 cut(s) 413
HpySE526I ACGT 4 cut(s) 245, 455, 502, 770
Hsp92I GRCGYC 1 cut(s) 420
Hsp92II CATG 4 cut(s) 391, 433, 844, 854
Ksp22I TGATCA 1 cut(s) 870
Kzo9I GATC 2 cut(s) 258, 870
LweI GCATC 3 cut(s) 331, 703, 724
MaeI CTAG 1 cut(s) 720
MaeII ACGT 4 cut(s) 245, 455, 502, 770
MaeIII GTNAC 8 cut(s) 28, 241, 416, 491, 585, 749, 791, 856
MalI GATC 2 cut(s) 260, 872
MboI GATC 2 cut(s) 258, 870
MboII GAAGA 2 cut(s) 124, 418
MluCI AATT 6 cut(s) 130, 380, 468, 617, 670, 783
MlyI GAGTC 3 cut(s) 223, 308, 856
MmeI TCCRAC 1 cut(s) 615
MnlI CCTC 4 cut(s) 108, 167, 283, 517
MroXI GAANNNNTTC 2 cut(s) 93, 408
MslI CAYNNNNRTG 2 cut(s) 428, 512
MspR9I CCNGG 1 cut(s) 485
MvaI CCWGG 1 cut(s) 485
MwoI GCNNNNNNNGC 2 cut(s) 384, 604
NdeII GATC 2 cut(s) 258, 870
NlaIII CATG 4 cut(s) 391, 433, 844, 854
NlaIV GGNNCC 1 cut(s) 178
NmuCI GTSAC 4 cut(s) 241, 416, 491, 585
NspI RCATGY 1 cut(s) 844
PacI TTAATTAA 1 cut(s) 471
PdmI GAANNNNTTC 2 cut(s) 93, 408
PfeI GAWTC 2 cut(s) 409, 808
PflMI CCANNNNNTGG 1 cut(s) 660
PleI GAGTC 3 cut(s) 223, 307, 855
PpsI GAGTC 3 cut(s) 223, 307, 855
Ppu21I YACGTR 2 cut(s) 246, 456
PshBI ATTAAT 1 cut(s) 620
PsiI TTATAA 1 cut(s) 680
Psp6I CCWGG 1 cut(s) 483
PspEI GGTNACC 1 cut(s) 749
PspGI CCWGG 1 cut(s) 483
PspN4I GGNNCC 1 cut(s) 178
RseI CAYNNNNRTG 2 cut(s) 428, 512
Sau3AI GATC 2 cut(s) 258, 870
SchI GAGTC 3 cut(s) 223, 308, 856
ScrFI CCNGG 1 cut(s) 485
SfaNI GCATC 3 cut(s) 331, 703, 724
SmiMI CAYNNNNRTG 2 cut(s) 428, 512
Sse9I AATT 6 cut(s) 130, 380, 468, 617, 670, 783
SspI AATATT 1 cut(s) 553
SspMI CTAG 1 cut(s) 720
StyD4I CCNGG 1 cut(s) 483
TaaI ACNGT 3 cut(s) 359, 797, 804
TaiI ACGT 4 cut(s) 248, 458, 505, 773
TaqI TCGA 1 cut(s) 825
TasI AATT 6 cut(s) 130, 380, 468, 617, 670, 783
TfiI GAWTC 2 cut(s) 409, 808
TscAI CASTG 2 cut(s) 421, 519
TseFI GTSAC 4 cut(s) 241, 416, 491, 585
Tsp45I GTSAC 4 cut(s) 241, 416, 491, 585
TspDTI ATGAA 3 cut(s) 142, 418, 638
TspRI CASTG 2 cut(s) 421, 519
Van91I CCANNNNNTGG 1 cut(s) 660
VspI ATTAAT 1 cut(s) 620
XapI RAATTY 1 cut(s) 130
XceI RCATGY 1 cut(s) 844
XmnI GAANNNNTTC 2 cut(s) 93, 408
XspI CTAG 1 cut(s) 720
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.