Rmu_co8361075.1_g000001

positive regulation of cell-substrate adhesion

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8361075.1
N/A
Physical Location & Seq
Forward (+)
1 .. 818
818 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8361075.1_g000001.1.cds

Sequence Viewer

Length: 362 bp
aatctctgccatcaagttgtcaaccggatcggcttgttgaacttaagatgcctaatagccgcattgaacaactatggaatgaaaggcttgcattaaaaatgctagtgctaattgatctttcctactgccaatacttaaggaggactctcgacttcagtagggtcccaaatcttgagcggctaaactttgaagctcaaagagtttccagagattgttggaggaatgaaatctttggcagaactttacttagatgggacggctataaggaagctgccgatatcaatccaacacttgagtggccttattttgctgaatttaaaaggctgcaaataccttctgggtcttccaagcgtcgtttgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04064 ko04115 ko04210 map04064 map04115 map04210
Pfam Domains
Protein Families
Death LRR_8 Peptidase_S68 ZU5

Protein Analysis

119

Amino Acids

14.26

Weight (kDa)

9.4

Isoelectric Point (pI)

65.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 177
AciI CCGC 2 cut(s) 60, 177
AclWI GGATC 1 cut(s) 35
AcsI RAATTY 1 cut(s) 313
AcuI CTGAAG 1 cut(s) 138
AflII CTTAAG 2 cut(s) 43, 135
AgsI TTSAA 3 cut(s) 40, 67, 190
AleI CACNNNNGTG 1 cut(s) 294
AluBI AGCT 2 cut(s) 193, 271
AluI AGCT 2 cut(s) 193, 271
AlwI GGATC 1 cut(s) 35
AoxI GGCC 1 cut(s) 298
ApeKI GCWGC 2 cut(s) 271, 324
ApoI RAATTY 1 cut(s) 313
AspS9I GGNCC 1 cut(s) 162
AvaII GGWCC 1 cut(s) 162
BbsI GAAGAC 1 cut(s) 335
BbvI GCAGC 2 cut(s) 258, 311
BccI CCATC 2 cut(s) 18, 245
BceAI ACGGC 1 cut(s) 273
BfaI CTAG 1 cut(s) 103
BfrI CTTAAG 2 cut(s) 43, 135
BisI GCNGC 4 cut(s) 60, 178, 272, 325
BlsI GCNGC 4 cut(s) 61, 179, 273, 326
Bme18I GGWCC 1 cut(s) 162
BmgT120I GGNCC 1 cut(s) 162
BmiI GGNNCC 2 cut(s) 163, 164
BmsI GCATC 1 cut(s) 38
BpiI GAAGAC 1 cut(s) 335
BpuEI CTTGAG 2 cut(s) 193, 313
BsaBI GATNNNNATC 1 cut(s) 281
BsaWI WCCGGW 1 cut(s) 24
Bse8I GATNNNNATC 1 cut(s) 281
BseJI GATNNNNATC 1 cut(s) 281
BseXI GCAGC 2 cut(s) 258, 311
BshFI GGCC 1 cut(s) 300
BsiSI CCGG 1 cut(s) 25
BslFI GGGAC 2 cut(s) 148, 268
BsmFI GGGAC 2 cut(s) 148, 268
BsnI GGCC 1 cut(s) 300
Bsp143I GATC 2 cut(s) 27, 114
BspACI CCGC 2 cut(s) 60, 177
BspANI GGCC 1 cut(s) 300
BspLI GGNNCC 2 cut(s) 163, 164
BspPI GGATC 1 cut(s) 35
BspTI CTTAAG 2 cut(s) 43, 135
BsrBI CCGCTC 1 cut(s) 177
BssMI GATC 2 cut(s) 27, 114
BstAFI CTTAAG 2 cut(s) 43, 135
BstC8I GCNNGC 1 cut(s) 89
BstDEI CTNAG 1 cut(s) 247
BstKTI GATC 2 cut(s) 30, 117
BstMBI GATC 2 cut(s) 27, 114
BstV1I GCAGC 2 cut(s) 258, 311
BstV2I GAAGAC 1 cut(s) 335
BsuRI GGCC 1 cut(s) 300
Cac8I GCNNGC 1 cut(s) 89
Cfr13I GGNCC 1 cut(s) 162
CseI GACGC 1 cut(s) 340
CviJI RGCY 9 cut(s) 33, 59, 87, 180, 193, 260, 271, 300, 324
CviKI_1 RGCY 9 cut(s) 33, 59, 87, 180, 193, 260, 271, 300, 324
DdeI CTNAG 1 cut(s) 247
DpnI GATC 2 cut(s) 29, 116
DpnII GATC 2 cut(s) 27, 114
DraI TTTAAA 1 cut(s) 318
Eco32I GATATC 1 cut(s) 279
Eco47I GGWCC 1 cut(s) 162
Eco57I CTGAAG 1 cut(s) 138
EcoO109I RGGNCCY 1 cut(s) 162
EcoRV GATATC 1 cut(s) 279
FaiI YATR 2 cut(s) 75, 263
FaqI GGGAC 2 cut(s) 148, 268
Fnu4HI GCNGC 4 cut(s) 60, 178, 272, 325
Fsp4HI GCNGC 4 cut(s) 60, 178, 272, 325
FspBI CTAG 1 cut(s) 103
GluI GCNGC 4 cut(s) 60, 178, 272, 325
HaeIII GGCC 1 cut(s) 300
HapII CCGG 1 cut(s) 25
HgaI GACGC 1 cut(s) 340
HincII GTYRAC 1 cut(s) 22
HindII GTYRAC 1 cut(s) 22
HinfI GANTC 1 cut(s) 144
HpaII CCGG 1 cut(s) 25
Hpy166II GTNNAC 1 cut(s) 22
Hpy188III TCNNGA 3 cut(s) 148, 172, 206
Hpy8I GTNNAC 1 cut(s) 22
Hpy99I CGWCG 1 cut(s) 356
HpyAV CCTTC 1 cut(s) 344
HpyCH4V TGCA 2 cut(s) 91, 327
HpyF3I CTNAG 1 cut(s) 247
KflI GGGWCCC 1 cut(s) 162
Kzo9I GATC 2 cut(s) 27, 114
LpnPI CCDG 3 cut(s) 38, 219, 323
Lsp1109I GCAGC 2 cut(s) 258, 311
LweI GCATC 1 cut(s) 38
MaeI CTAG 1 cut(s) 103
MalI GATC 2 cut(s) 29, 116
MbiI CCGCTC 1 cut(s) 177
MboI GATC 2 cut(s) 27, 114
MboII GAAGA 1 cut(s) 335
MluCI AATT 2 cut(s) 110, 313
MlyI GAGTC 1 cut(s) 138
MmeI TCCRAC 2 cut(s) 196, 310
MnlI CCTC 2 cut(s) 134, 212
MseI TTAA 4 cut(s) 44, 94, 136, 317
MslI CAYNNNNRTG 1 cut(s) 294
MspCI CTTAAG 2 cut(s) 43, 135
MspI CCGG 1 cut(s) 25
NdeII GATC 2 cut(s) 27, 114
NlaIV GGNNCC 2 cut(s) 163, 164
OliI CACNNNNGTG 1 cut(s) 294
PkrI GCNGC 4 cut(s) 61, 179, 273, 326
PleI GAGTC 1 cut(s) 138
PpsI GAGTC 1 cut(s) 138
PpuMI RGGWCCY 1 cut(s) 162
Psp5II RGGWCCY 1 cut(s) 162
PspN4I GGNNCC 2 cut(s) 163, 164
PspPI GGNCC 1 cut(s) 162
PspPPI RGGWCCY 1 cut(s) 162
RseI CAYNNNNRTG 1 cut(s) 294
SaqAI TTAA 4 cut(s) 44, 94, 136, 317
SatI GCNGC 4 cut(s) 60, 178, 272, 325
Sau3AI GATC 2 cut(s) 27, 114
Sau96I GGNCC 1 cut(s) 162
SchI GAGTC 1 cut(s) 138
SetI ASST 3 cut(s) 195, 273, 336
SfaNI GCATC 1 cut(s) 38
SinI GGWCC 1 cut(s) 162
SmiMI CAYNNNNRTG 1 cut(s) 294
SmlI CTYRAG 4 cut(s) 43, 135, 172, 292
SmoI CTYRAG 4 cut(s) 43, 135, 172, 292
Sse9I AATT 2 cut(s) 110, 313
SsiI CCGC 2 cut(s) 60, 177
SspMI CTAG 1 cut(s) 103
TaqI TCGA 1 cut(s) 149
TasI AATT 2 cut(s) 110, 313
TauI GCSGC 2 cut(s) 62, 180
Tru1I TTAA 4 cut(s) 44, 94, 136, 317
Tru9I TTAA 4 cut(s) 44, 94, 136, 317
TseI GCWGC 2 cut(s) 271, 324
TspDTI ATGAA 2 cut(s) 95, 239
Vha464I CTTAAG 2 cut(s) 43, 135
VpaK11BI GGWCC 1 cut(s) 162
XapI RAATTY 1 cut(s) 313
XcmI CCANNNNNNNNNTGG 1 cut(s) 293
XspI CTAG 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.