Rmu_co8375657.1_g000001

Leucine-rich repeat

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8375657.1
N/A
Physical Location & Seq
Reverse (-)
2 .. 393
392 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8375657.1_g000001.1.cds

Sequence Viewer

Length: 279 bp
atggttaggttttcgtgtttccaagctcacatctattccccaaagcctaagaaaagttttcaaccctctgtcgaagcgatgcagaagtcactacaagattcttctaaaaatccagctttgaatttgaaggattcgtctggagaaacaagcttaaaaccatcacaggcagaaggattgtctcaaactagtagaaatttaaagcatgtattgtctcttcagcctgttcggaaatcagatgacaatgaaagcaacttcattgatgaaagtgacatcaaggtc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.37

Weight (kDa)

8.79

Isoelectric Point (pI)

53.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 275
AcsI RAATTY 2 cut(s) 121, 193
AcuI CTGAAG 1 cut(s) 200
AgsI TTSAA 3 cut(s) 62, 121, 127
AhlI ACTAGT 1 cut(s) 185
AluBI AGCT 3 cut(s) 26, 116, 150
AluI AGCT 3 cut(s) 26, 116, 150
Alw26I GTCTC 2 cut(s) 183, 216
ApoI RAATTY 2 cut(s) 121, 193
BarI GAAGNNNNNNTAC 2 cut(s) 198, 230
BccI CCATC 1 cut(s) 166
BcoDI GTCTC 2 cut(s) 183, 216
BcuI ACTAGT 1 cut(s) 185
BfaI CTAG 1 cut(s) 186
BmsI GCATC 1 cut(s) 69
BpmI CTGGAG 1 cut(s) 159
BsmAI GTCTC 2 cut(s) 183, 216
Bst6I CTCTTC 1 cut(s) 219
BstDEI CTNAG 1 cut(s) 48
BstMAI GTCTC 2 cut(s) 183, 216
BstNSI RCATGY 1 cut(s) 206
BtgZI GCGATG 1 cut(s) 92
CviAII CATG 1 cut(s) 203
CviJI RGCY 5 cut(s) 26, 46, 116, 150, 220
CviKI_1 RGCY 5 cut(s) 26, 46, 116, 150, 220
DdeI CTNAG 1 cut(s) 48
DraI TTTAAA 1 cut(s) 198
DrdI GACNNNNNNGTC 1 cut(s) 275
DseDI GACNNNNNNGTC 1 cut(s) 275
Eam1104I CTCTTC 1 cut(s) 219
EarI CTCTTC 1 cut(s) 219
Eco57I CTGAAG 1 cut(s) 200
FaeI CATG 1 cut(s) 206
FaiI YATR 1 cut(s) 204
FatI CATG 1 cut(s) 202
FspBI CTAG 1 cut(s) 186
GsuI CTGGAG 1 cut(s) 159
Hin1II CATG 1 cut(s) 206
HindIII AAGCTT 1 cut(s) 148
HinfI GANTC 2 cut(s) 98, 131
Hpy188I TCNGA 2 cut(s) 228, 235
Hpy188III TCNNGA 1 cut(s) 138
HpyAV CCTTC 2 cut(s) 121, 164
HpyCH4V TGCA 1 cut(s) 82
HpyF3I CTNAG 1 cut(s) 48
Hsp92II CATG 1 cut(s) 206
LpnPI CCDG 4 cut(s) 123, 126, 149, 234
LweI GCATC 1 cut(s) 69
MaeI CTAG 1 cut(s) 186
MaeIII GTNAC 2 cut(s) 87, 266
MboII GAAGA 2 cut(s) 93, 206
MluCI AATT 2 cut(s) 121, 193
MnlI CCTC 1 cut(s) 76
MseI TTAA 2 cut(s) 152, 197
NlaIII CATG 1 cut(s) 206
NmuCI GTSAC 2 cut(s) 87, 266
NspI RCATGY 1 cut(s) 206
PfeI GAWTC 2 cut(s) 98, 131
SaqAI TTAA 2 cut(s) 152, 197
SetI ASST 5 cut(s) 11, 28, 118, 152, 279
SfaNI GCATC 1 cut(s) 69
SpeI ACTAGT 1 cut(s) 185
Sse9I AATT 2 cut(s) 121, 193
SspMI CTAG 1 cut(s) 186
TaqI TCGA 1 cut(s) 72
TasI AATT 2 cut(s) 121, 193
TfiI GAWTC 2 cut(s) 98, 131
Tru1I TTAA 2 cut(s) 152, 197
Tru9I TTAA 2 cut(s) 152, 197
TseFI GTSAC 2 cut(s) 87, 266
Tsp45I GTSAC 2 cut(s) 87, 266
TspDTI ATGAA 3 cut(s) 244, 258, 276
XapI RAATTY 2 cut(s) 121, 193
XceI RCATGY 1 cut(s) 206
XspI CTAG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.