Rmu_sc0000040.1_g000002

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000040.1
N/A
Physical Location & Seq
Reverse (-)
16429 .. 17016
588 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 528 bp
atgaggggtttccgtgatgcattgggatatggtgatcttgctgatctagggtttaagggtgcaaagatgacctggtggaactttgagactcaaatatgcttggaaagagcagttgcaacctctacatggagtgacatctttggttattcaagggtgaagcacttgccacccaatgattctgaccacgttcccattctactacaagctagttcgcaccaagagtgtgatcctcttgtgttacctaatttgaaagcagaagatggaggtgctcttacgtttgtactaacaagaaagatcattaatatgagatgtgccttggaatcttggcagcatgatacctttagactgcatcaaaatcagatgatggatattcagagcatagtgggagtgcttatgaatgagtctatgtctgaggcagtttacaatgagaagaaagatttaatgatttctttacaggatattttgtcgcaggaagaggtgcgcattttggaagcaacgggccaaggttacttggttgtaagagggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

175

Amino Acids

19.82

Weight (kDa)

5.16

Isoelectric Point (pI)

35.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 482
AclWI GGATC 1 cut(s) 221
AfaI GTAC 1 cut(s) 282
AfiI CCNNNNNNNGG 1 cut(s) 126
AgsI TTSAA 2 cut(s) 150, 250
AjnI CCWGG 1 cut(s) 71
AluBI AGCT 1 cut(s) 206
AluI AGCT 1 cut(s) 206
Alw21I GWGCWC 1 cut(s) 271
Alw26I GTCTC 1 cut(s) 80
AlwI GGATC 1 cut(s) 221
AoxI GGCC 1 cut(s) 499
ApeKI GCWGC 1 cut(s) 328
AseI ATTAAT 1 cut(s) 300
AspLEI GCGC 1 cut(s) 483
AspS9I GGNCC 1 cut(s) 499
AsuHPI GGTGA 2 cut(s) 44, 166
Bbv12I GWGCWC 1 cut(s) 271
BbvI GCAGC 1 cut(s) 340
BccI CCATC 2 cut(s) 254, 358
BciT130I CCWGG 1 cut(s) 73
BcoDI GTCTC 1 cut(s) 80
BfaI CTAG 2 cut(s) 47, 207
BisI GCNGC 1 cut(s) 329
BlsI GCNGC 1 cut(s) 330
Bme1390I CCNGG 1 cut(s) 73
BmgT120I GGNCC 1 cut(s) 499
BmrFI CCNGG 1 cut(s) 73
BmsI GCATC 2 cut(s) 7, 358
BsaJI CCNNGG 2 cut(s) 315, 502
Bsc4I CCNNNNNNNGG 1 cut(s) 126
BseBI CCWGG 1 cut(s) 73
BseDI CCNNGG 2 cut(s) 315, 502
BseLI CCNNNNNNNGG 1 cut(s) 126
BseMII CTCAG 1 cut(s) 402
BseXI GCAGC 1 cut(s) 340
BshFI GGCC 1 cut(s) 501
BsiHKAI GWGCWC 1 cut(s) 271
BslI CCNNNNNNNGG 1 cut(s) 126
BsmAI GTCTC 1 cut(s) 80
BsnI GGCC 1 cut(s) 501
Bsp1286I GDGCHC 1 cut(s) 271
Bsp143I GATC 4 cut(s) 34, 43, 226, 294
BspANI GGCC 1 cut(s) 501
BspCNI CTCAG 1 cut(s) 403
BspPI GGATC 1 cut(s) 221
BssECI CCNNGG 2 cut(s) 315, 502
BssMI GATC 4 cut(s) 34, 43, 226, 294
BssT1I CCWWGG 2 cut(s) 315, 502
Bst2UI CCWGG 1 cut(s) 73
Bst6I CTCTTC 1 cut(s) 468
BstDEI CTNAG 1 cut(s) 411
BstHHI GCGC 1 cut(s) 483
BstKTI GATC 4 cut(s) 37, 46, 229, 297
BstMAI GTCTC 1 cut(s) 80
BstMBI GATC 4 cut(s) 34, 43, 226, 294
BstNI CCWGG 1 cut(s) 73
BstSCI CCNGG 1 cut(s) 71
BstV1I GCAGC 1 cut(s) 340
BsuRI GGCC 1 cut(s) 501
CfoI GCGC 1 cut(s) 483
Cfr13I GGNCC 1 cut(s) 499
CsiI ACCWGGT 1 cut(s) 71
Csp6I GTAC 1 cut(s) 281
CviAII CATG 2 cut(s) 126, 332
CviJI RGCY 2 cut(s) 206, 501
CviKI_1 RGCY 2 cut(s) 206, 501
CviQI GTAC 1 cut(s) 281
DdeI CTNAG 1 cut(s) 411
DpnI GATC 4 cut(s) 36, 45, 228, 296
DpnII GATC 4 cut(s) 34, 43, 226, 294
Eam1104I CTCTTC 1 cut(s) 468
EarI CTCTTC 1 cut(s) 468
Eco130I CCWWGG 2 cut(s) 315, 502
EcoRII CCWGG 1 cut(s) 71
EcoT14I CCWWGG 2 cut(s) 315, 502
EcoT22I ATGCAT 1 cut(s) 22
ErhI CCWWGG 2 cut(s) 315, 502
FaeI CATG 2 cut(s) 129, 335
FaiI YATR 8 cut(s) 30, 97, 127, 305, 333, 380, 395, 407
FatI CATG 2 cut(s) 125, 331
Fnu4HI GCNGC 1 cut(s) 329
Fsp4HI GCNGC 1 cut(s) 329
FspAI RTGCGCAY 1 cut(s) 482
FspBI CTAG 2 cut(s) 47, 207
FspI TGCGCA 1 cut(s) 482
GlaI GCGC 1 cut(s) 482
GluI GCNGC 1 cut(s) 329
HaeIII GGCC 1 cut(s) 501
HhaI GCGC 1 cut(s) 483
Hin1II CATG 2 cut(s) 129, 335
Hin6I GCGC 1 cut(s) 481
HinP1I GCGC 1 cut(s) 481
HinfI GANTC 4 cut(s) 88, 176, 320, 401
HphI GGTGA 2 cut(s) 44, 166
Hpy166II GTNNAC 1 cut(s) 421
Hpy188I TCNGA 4 cut(s) 181, 360, 375, 412
Hpy8I GTNNAC 1 cut(s) 421
HpyCH4IV ACGT 2 cut(s) 186, 275
HpyCH4V TGCA 4 cut(s) 20, 62, 116, 349
HpyF3I CTNAG 1 cut(s) 411
HpySE526I ACGT 2 cut(s) 186, 275
Hsp92II CATG 2 cut(s) 129, 335
HspAI GCGC 1 cut(s) 481
Kzo9I GATC 4 cut(s) 34, 43, 226, 294
LpnPI CCDG 4 cut(s) 58, 85, 440, 455
Lsp1109I GCAGC 1 cut(s) 340
LweI GCATC 2 cut(s) 7, 358
MabI ACCWGGT 1 cut(s) 71
MaeI CTAG 2 cut(s) 47, 207
MaeII ACGT 2 cut(s) 186, 275
MaeIII GTNAC 3 cut(s) 131, 237, 506
MalI GATC 4 cut(s) 36, 45, 228, 296
MboI GATC 4 cut(s) 34, 43, 226, 294
MboII GAAGA 3 cut(s) 269, 442, 485
MhlI GDGCHC 1 cut(s) 271
MluCI AATT 1 cut(s) 244
MlyI GAGTC 2 cut(s) 82, 410
MnlI CCTC 6 cut(s) 130, 240, 257, 406, 469, 515
Mph1103I ATGCAT 1 cut(s) 22
MseI TTAA 3 cut(s) 54, 300, 440
MslI CAYNNNNRTG 1 cut(s) 302
MspR9I CCNGG 1 cut(s) 73
MvaI CCWGG 1 cut(s) 73
NdeII GATC 4 cut(s) 34, 43, 226, 294
NlaIII CATG 2 cut(s) 129, 335
NmuCI GTSAC 1 cut(s) 131
NsbI TGCGCA 1 cut(s) 482
NsiI ATGCAT 1 cut(s) 22
PfeI GAWTC 2 cut(s) 176, 320
PkrI GCNGC 1 cut(s) 330
PleI GAGTC 2 cut(s) 82, 409
PpsI GAGTC 2 cut(s) 82, 409
PshBI ATTAAT 1 cut(s) 300
Psp6I CCWGG 1 cut(s) 71
PspGI CCWGG 1 cut(s) 71
PspPI GGNCC 1 cut(s) 499
RsaI GTAC 1 cut(s) 282
RsaNI GTAC 1 cut(s) 281
RseI CAYNNNNRTG 1 cut(s) 302
SaqAI TTAA 3 cut(s) 54, 300, 440
SatI GCNGC 1 cut(s) 329
Sau3AI GATC 4 cut(s) 34, 43, 226, 294
Sau96I GGNCC 1 cut(s) 499
SchI GAGTC 2 cut(s) 82, 410
ScrFI CCNGG 1 cut(s) 73
SduI GDGCHC 1 cut(s) 271
SexAI ACCWGGT 1 cut(s) 71
SfaNI GCATC 2 cut(s) 7, 358
SmiMI CAYNNNNRTG 1 cut(s) 302
Sse9I AATT 1 cut(s) 244
SspMI CTAG 2 cut(s) 47, 207
StyD4I CCNGG 1 cut(s) 71
StyI CCWWGG 2 cut(s) 315, 502
TaiI ACGT 2 cut(s) 189, 278
TasI AATT 1 cut(s) 244
TatI WGTACW 1 cut(s) 280
TfiI GAWTC 2 cut(s) 176, 320
Tru1I TTAA 3 cut(s) 54, 300, 440
Tru9I TTAA 3 cut(s) 54, 300, 440
TseFI GTSAC 1 cut(s) 131
TseI GCWGC 1 cut(s) 328
Tsp45I GTSAC 1 cut(s) 131
TspDTI ATGAA 1 cut(s) 410
VspI ATTAAT 1 cut(s) 300
XspI CTAG 2 cut(s) 47, 207
Zsp2I ATGCAT 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.