Rmu_sc0000070.1_g000063

Ribosomal protein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000070.1
N/A
Physical Location & Seq
Reverse (-)
225328 .. 225867
540 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 540 bp
atgaatcgtttgacgaaatggttgcagaaagatcaagaagaggccatcacaagaagccgtcgacgagccttgatgatgtctgccactgccttgcaaatccaaactctggaagatgaggattcacaatggggtggttcttcaaaatgtcatacctataaggctagggatcgagagctgatggatcttcgactcaaaactcaatacttcacggatctgtgcaggtatgaatcaaacatattttgtaggcgatatagaatgcaaccttgggtctttgacaggatgatgcgcgacgtggacaactacgacccatattttgttcaattaagagatgcttgtgggagactcagcttatccactgaacaaaagctgacatgcgccatgagaatgctcgcgtatggcatcacaactgatttctacgatgattacctagatattgcgaagaccactgccattgagattattgagcacttcacaaaagcaatctggaatgtgtaccatgagacttacctccgccgaccaacaccggcagatttgcaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plant_tran

Protein Analysis

179

Amino Acids

21.53

Weight (kDa)

7.61

Isoelectric Point (pI)

60.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 210
AccB7I CCANNNNNTGG 1 cut(s) 106
AccI GTMKAC 1 cut(s) 61
AccII CGCG 2 cut(s) 288, 392
AciI CCGC 1 cut(s) 511
AclWI GGATC 3 cut(s) 174, 189, 219
AfaI GTAC 1 cut(s) 494
AfiI CCNNNNNNNGG 1 cut(s) 106
AgsI TTSAA 2 cut(s) 141, 320
AjiI CACGTC 1 cut(s) 292
AjuI GAANNNNNNNTTGG 2 cut(s) 247, 279
AluBI AGCT 3 cut(s) 175, 348, 367
AluI AGCT 3 cut(s) 175, 348, 367
Alw21I GWGCWC 1 cut(s) 468
Alw26I GTCTC 2 cut(s) 334, 494
AlwI GGATC 3 cut(s) 174, 189, 219
AoxI GGCC 1 cut(s) 42
ArsI GACNNNNNNTTYG 2 cut(s) 296, 328
AspLEI GCGC 2 cut(s) 288, 377
BbsI GAAGAC 1 cut(s) 446
Bbv12I GWGCWC 1 cut(s) 468
BccI CCATC 2 cut(s) 53, 172
BceAI ACGGC 1 cut(s) 42
BcgI CGANNNNNNTGC 2 cut(s) 4, 38
BcoDI GTCTC 2 cut(s) 334, 494
BfaI CTAG 2 cut(s) 162, 428
BfuAI ACCTGC 1 cut(s) 210
BmgBI CACGTC 1 cut(s) 292
BmsI GCATC 3 cut(s) 273, 319, 408
BpiI GAAGAC 1 cut(s) 446
BsaJI CCNNGG 1 cut(s) 263
Bsc4I CCNNNNNNNGG 1 cut(s) 106
Bse118I RCCGGY 1 cut(s) 523
BseDI CCNNGG 1 cut(s) 263
BseGI GGATG 1 cut(s) 285
BseLI CCNNNNNNNGG 1 cut(s) 106
BseMII CTCAG 1 cut(s) 358
BsgI GTGCAG 1 cut(s) 238
Bsh1236I CGCG 2 cut(s) 288, 392
BshFI GGCC 1 cut(s) 44
BsiHKAI GWGCWC 1 cut(s) 468
BsiSI CCGG 1 cut(s) 524
BslI CCNNNNNNNGG 1 cut(s) 106
BsmAI GTCTC 2 cut(s) 334, 494
BsmI GAATGC 2 cut(s) 261, 390
BsnI GGCC 1 cut(s) 44
Bsp1286I GDGCHC 1 cut(s) 468
Bsp143I GATC 4 cut(s) 31, 166, 181, 211
BspACI CCGC 1 cut(s) 511
BspANI GGCC 1 cut(s) 44
BspCNI CTCAG 1 cut(s) 357
BspFNI CGCG 2 cut(s) 288, 392
BspMI ACCTGC 1 cut(s) 210
BspPI GGATC 3 cut(s) 174, 189, 219
BsrFI RCCGGY 1 cut(s) 523
BssAI RCCGGY 1 cut(s) 523
BssECI CCNNGG 1 cut(s) 263
BssMI GATC 4 cut(s) 31, 166, 181, 211
BssT1I CCWWGG 1 cut(s) 263
Bst6I CTCTTC 1 cut(s) 33
BstC8I GCNNGC 1 cut(s) 390
BstDEI CTNAG 1 cut(s) 344
BstF5I GGATG 1 cut(s) 285
BstFNI CGCG 2 cut(s) 288, 392
BstHHI GCGC 2 cut(s) 288, 377
BstKTI GATC 4 cut(s) 34, 169, 184, 214
BstMAI GTCTC 2 cut(s) 334, 494
BstMBI GATC 4 cut(s) 31, 166, 181, 211
BstNSI RCATGY 1 cut(s) 375
BstUI CGCG 2 cut(s) 288, 392
BstV2I GAAGAC 1 cut(s) 446
BstX2I RGATCY 2 cut(s) 181, 211
BstYI RGATCY 2 cut(s) 181, 211
BsuRI GGCC 1 cut(s) 44
BtrI CACGTC 1 cut(s) 292
BtsCI GGATG 1 cut(s) 285
BtsI GCAGTG 2 cut(s) 84, 444
BtsIMutI CAGTG 3 cut(s) 84, 354, 444
BveI ACCTGC 1 cut(s) 210
Cac8I GCNNGC 1 cut(s) 390
CfoI GCGC 2 cut(s) 288, 377
Cfr10I RCCGGY 1 cut(s) 523
Csp6I GTAC 1 cut(s) 493
CspCI CAANNNNNGTGG 2 cut(s) 433, 468
CviAII CATG 3 cut(s) 372, 379, 497
CviJI RGCY 7 cut(s) 44, 57, 68, 161, 175, 348, 367
CviKI_1 RGCY 7 cut(s) 44, 57, 68, 161, 175, 348, 367
CviQI GTAC 1 cut(s) 493
DdeI CTNAG 1 cut(s) 344
DpnI GATC 4 cut(s) 33, 168, 183, 213
DpnII GATC 4 cut(s) 31, 166, 181, 211
Eam1104I CTCTTC 1 cut(s) 33
EarI CTCTTC 1 cut(s) 33
EciI GGCGGA 1 cut(s) 500
Eco130I CCWWGG 1 cut(s) 263
EcoT14I CCWWGG 1 cut(s) 263
ErhI CCWWGG 1 cut(s) 263
FaeI CATG 3 cut(s) 375, 382, 500
FalI AAGNNNNNCTT 2 cut(s) 316, 348
FatI CATG 3 cut(s) 371, 378, 496
FblI GTMKAC 1 cut(s) 61
FokI GGATG 1 cut(s) 292
FspBI CTAG 2 cut(s) 162, 428
GlaI GCGC 2 cut(s) 287, 376
HaeIII GGCC 1 cut(s) 44
HapII CCGG 1 cut(s) 524
HhaI GCGC 2 cut(s) 288, 377
Hin1II CATG 3 cut(s) 375, 382, 500
Hin6I GCGC 2 cut(s) 286, 375
HinP1I GCGC 2 cut(s) 286, 375
HincII GTYRAC 1 cut(s) 62
HindII GTYRAC 1 cut(s) 62
HinfI GANTC 5 cut(s) 4, 119, 189, 227, 342
HpaII CCGG 1 cut(s) 524
Hpy166II GTNNAC 3 cut(s) 62, 295, 493
Hpy188III TCNNGA 4 cut(s) 35, 107, 170, 484
Hpy8I GTNNAC 3 cut(s) 62, 295, 493
Hpy99I CGWCG 3 cut(s) 63, 66, 293
HpyCH4IV ACGT 1 cut(s) 291
HpyCH4V TGCA 5 cut(s) 25, 94, 219, 259, 535
HpyF3I CTNAG 1 cut(s) 344
HpySE526I ACGT 1 cut(s) 291
Hsp92II CATG 3 cut(s) 375, 382, 500
HspAI GCGC 2 cut(s) 286, 375
Kzo9I GATC 4 cut(s) 31, 166, 181, 211
LpnPI CCDG 4 cut(s) 92, 205, 262, 469
LweI GCATC 3 cut(s) 273, 319, 408
MaeI CTAG 2 cut(s) 162, 428
MaeII ACGT 1 cut(s) 291
MalI GATC 4 cut(s) 33, 168, 183, 213
MboI GATC 4 cut(s) 31, 166, 181, 211
MboII GAAGA 5 cut(s) 50, 122, 129, 176, 451
MflI RGATCY 2 cut(s) 181, 211
MhlI GDGCHC 1 cut(s) 468
MluCI AATT 1 cut(s) 320
MlyI GAGTC 2 cut(s) 183, 336
MnlI CCTC 3 cut(s) 34, 109, 518
MseI TTAA 1 cut(s) 323
MslI CAYNNNNRTG 1 cut(s) 383
MspI CCGG 1 cut(s) 524
Mva1269I GAATGC 2 cut(s) 261, 390
MvnI CGCG 2 cut(s) 288, 392
NdeII GATC 4 cut(s) 31, 166, 181, 211
NlaIII CATG 3 cut(s) 375, 382, 500
NspI RCATGY 1 cut(s) 375
PctI GAATGC 2 cut(s) 261, 390
PfeI GAWTC 3 cut(s) 4, 119, 227
PflMI CCANNNNNTGG 1 cut(s) 106
PleI GAGTC 2 cut(s) 183, 336
PpsI GAGTC 2 cut(s) 183, 336
PsuI RGATCY 2 cut(s) 181, 211
RsaI GTAC 1 cut(s) 494
RsaNI GTAC 1 cut(s) 493
RseI CAYNNNNRTG 1 cut(s) 383
SalI GTCGAC 1 cut(s) 60
SaqAI TTAA 1 cut(s) 323
Sau3AI GATC 4 cut(s) 31, 166, 181, 211
SchI GAGTC 2 cut(s) 183, 336
SduI GDGCHC 1 cut(s) 468
SetI ASST 9 cut(s) 155, 177, 224, 265, 294, 350, 369, 429, 510
SfaNI GCATC 3 cut(s) 273, 319, 408
SgrDI CGTCGACG 1 cut(s) 60
SmiMI CAYNNNNRTG 1 cut(s) 383
Sse9I AATT 1 cut(s) 320
SsiI CCGC 1 cut(s) 511
SspMI CTAG 2 cut(s) 162, 428
StyI CCWWGG 1 cut(s) 263
TaiI ACGT 1 cut(s) 294
TaqI TCGA 3 cut(s) 61, 169, 187
TasI AATT 1 cut(s) 320
TfiI GAWTC 3 cut(s) 4, 119, 227
Tru1I TTAA 1 cut(s) 323
Tru9I TTAA 1 cut(s) 323
TscAI CASTG 3 cut(s) 91, 361, 451
TspDTI ATGAA 2 cut(s) 17, 240
TspGWI ACGGA 1 cut(s) 224
TspRI CASTG 3 cut(s) 91, 361, 451
Van91I CCANNNNNTGG 1 cut(s) 106
XceI RCATGY 1 cut(s) 375
XmiI GTMKAC 1 cut(s) 61
XspI CTAG 2 cut(s) 162, 428
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.