Rmu_sc0000084.1_g000025

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000084.1
N/A
Physical Location & Seq
Reverse (-)
85071 .. 86192
1122 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 723 bp
atgactttgatctcacagcacaagccagtgattgtctttctgattgaaacgaagatcagagagaaggatgagtttgggaggctgcagcggactctagggtttgatcatgcagagggtttcttaagtgtagaccaatccggttttcatggttgtccgtatacttggagcgattctgaaaccaaggttcggctggatagggtggtggtcacggtggcctggcttgattgcttttcgcattccagaatgatccatctgccgcccagtaaatcggatcacattccaattttgttccgacatgacagatgccatgaactggtacaagaacaatggtacaaacaggtctcggggcagccaatgtttttggttgccaagaaaattgaaagaacaagcattgcattggataaatggcaacatcctttctttggggataggcagaaggctatccatgcaattcgtggtaggttagaggagctgctggggttatctagctcaccagatttgcaggcagagaagaatgctttactggaaaggctagaagctttgctttcggaggaggagacttattggtgtcagagagctagagtctcatggctcaaggatggggataggaatacaagattctttcaccgtaatgcgtccaatagaaaactgaaattttttatccgtggcctgtatgatgaggcacgtgattggtatgaggataatgaagggttggaaaactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

240

Amino Acids

28.3

Weight (kDa)

6.84

Isoelectric Point (pI)

39.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 313
AccI GTMKAC 2 cut(s) 129, 158
AciI CCGC 2 cut(s) 88, 257
AclWI GGATC 2 cut(s) 241, 279
AcsI RAATTY 1 cut(s) 653
AcvI CACGTG 1 cut(s) 686
AfaI GTAC 2 cut(s) 318, 332
AfiI CCNNNNNNNGG 3 cut(s) 186, 313, 422
AflII CTTAAG 1 cut(s) 121
AgsI TTSAA 2 cut(s) 47, 380
AjnI CCWGG 1 cut(s) 215
AjuI GAANNNNNNNTTGG 2 cut(s) 126, 158
AluBI AGCT 4 cut(s) 472, 489, 539, 578
AluI AGCT 4 cut(s) 472, 489, 539, 578
Alw26I GTCTC 3 cut(s) 346, 551, 589
AlwI GGATC 2 cut(s) 241, 279
Ama87I CYCGRG 1 cut(s) 343
AoxI GGCC 2 cut(s) 213, 667
ApeKI GCWGC 4 cut(s) 82, 85, 349, 472
ApoI RAATTY 1 cut(s) 653
AsuHPI GGTGA 2 cut(s) 483, 617
AvaI CYCGRG 1 cut(s) 343
BbrPI CACGTG 1 cut(s) 686
BbvI GCAGC 4 cut(s) 69, 97, 361, 459
BccI CCATC 2 cut(s) 258, 593
BciT130I CCWGG 1 cut(s) 217
BclI TGATCA 1 cut(s) 103
BcoDI GTCTC 3 cut(s) 346, 551, 589
BfaI CTAG 4 cut(s) 95, 486, 533, 579
BfmI CTRYAG 1 cut(s) 83
BfrI CTTAAG 1 cut(s) 121
BisI GCNGC 5 cut(s) 83, 86, 257, 350, 473
BlsI GCNGC 5 cut(s) 84, 87, 258, 351, 474
Bme1390I CCNGG 1 cut(s) 217
BmeT110I CYCGRG 1 cut(s) 343
BmrFI CCNGG 1 cut(s) 217
BmrI ACTGGG 1 cut(s) 255
BmsI GCATC 1 cut(s) 293
BmuI ACTGGG 1 cut(s) 255
BpuEI CTTGAG 1 cut(s) 578
BsaAI YACGTR 1 cut(s) 686
BsaI GGTCTC 1 cut(s) 346
BsaJI CCNNGG 2 cut(s) 180, 664
BsaWI WCCGGW 1 cut(s) 137
Bsc4I CCNNNNNNNGG 3 cut(s) 186, 313, 422
Bse1I ACTGG 4 cut(s) 26, 261, 318, 528
Bse3DI GCAATG 1 cut(s) 390
BseBI CCWGG 1 cut(s) 217
BseDI CCNNGG 2 cut(s) 180, 664
BseGI GGATG 3 cut(s) 73, 412, 604
BseLI CCNNNNNNNGG 3 cut(s) 186, 313, 422
BseMI GCAATG 1 cut(s) 390
BseNI ACTGG 4 cut(s) 26, 261, 318, 528
BseRI GAGGAG 3 cut(s) 482, 566, 569
BseXI GCAGC 4 cut(s) 69, 97, 361, 459
BseYI CCCAGC 1 cut(s) 475
BshFI GGCC 2 cut(s) 215, 669
BsiHKCI CYCGRG 1 cut(s) 343
BsiSI CCGG 1 cut(s) 138
BslI CCNNNNNNNGG 3 cut(s) 186, 313, 422
BsmAI GTCTC 3 cut(s) 346, 551, 589
BsmI GAATGC 2 cut(s) 235, 520
BsnI GGCC 2 cut(s) 215, 669
Bso31I GGTCTC 1 cut(s) 346
BsoBI CYCGRG 1 cut(s) 343
Bsp143I GATC 5 cut(s) 9, 54, 103, 246, 271
BspACI CCGC 2 cut(s) 88, 257
BspANI GGCC 2 cut(s) 215, 669
BspMAI CTGCAG 1 cut(s) 87
BspPI GGATC 2 cut(s) 241, 279
BspTI CTTAAG 1 cut(s) 121
BspTNI GGTCTC 1 cut(s) 346
BsrDI GCAATG 1 cut(s) 390
BsrI ACTGG 4 cut(s) 26, 261, 318, 528
BssECI CCNNGG 2 cut(s) 180, 664
BssMI GATC 5 cut(s) 9, 54, 103, 246, 271
BssNAI GTATAC 1 cut(s) 159
BssT1I CCWWGG 1 cut(s) 180
Bst1107I GTATAC 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 217
Bst4CI ACNGT 2 cut(s) 211, 629
BstAFI CTTAAG 1 cut(s) 121
BstBAI YACGTR 1 cut(s) 686
BstC8I GCNNGC 1 cut(s) 504
BstDSI CCRYGG 1 cut(s) 664
BstF5I GGATG 3 cut(s) 73, 412, 604
BstKTI GATC 5 cut(s) 12, 57, 106, 249, 274
BstMAI GTCTC 3 cut(s) 346, 551, 589
BstMBI GATC 5 cut(s) 9, 54, 103, 246, 271
BstMWI GCNNNNNNNGC 1 cut(s) 446
BstNI CCWGG 1 cut(s) 217
BstSCI CCNGG 1 cut(s) 215
BstSFI CTRYAG 1 cut(s) 83
BstV1I GCAGC 4 cut(s) 69, 97, 361, 459
BstZ17I GTATAC 1 cut(s) 159
BsuRI GGCC 2 cut(s) 215, 669
BtgI CCRYGG 1 cut(s) 664
BtsCI GGATG 3 cut(s) 73, 412, 604
BtsIMutI CAGTG 1 cut(s) 33
Cac8I GCNNGC 1 cut(s) 504
CseI GACGC 1 cut(s) 624
Csp6I GTAC 2 cut(s) 317, 331
CviAII CATG 6 cut(s) 107, 146, 296, 308, 446, 588
CviQI GTAC 2 cut(s) 317, 331
DpnI GATC 5 cut(s) 11, 56, 105, 248, 273
DpnII GATC 5 cut(s) 9, 54, 103, 246, 271
Eco130I CCWWGG 1 cut(s) 180
Eco31I GGTCTC 1 cut(s) 346
Eco72I CACGTG 1 cut(s) 686
Eco88I CYCGRG 1 cut(s) 343
EcoRII CCWGG 1 cut(s) 215
EcoT14I CCWWGG 1 cut(s) 180
ErhI CCWWGG 1 cut(s) 180
FaeI CATG 6 cut(s) 110, 149, 299, 311, 449, 591
FaiI YATR 9 cut(s) 108, 147, 159, 297, 309, 447, 589, 675, 696
FalI AAGNNNNNCTT 2 cut(s) 528, 560
FatI CATG 6 cut(s) 106, 145, 295, 307, 445, 587
FbaI TGATCA 1 cut(s) 103
FblI GTMKAC 2 cut(s) 129, 158
Fnu4HI GCNGC 5 cut(s) 83, 86, 257, 350, 473
FokI GGATG 3 cut(s) 80, 399, 611
Fsp4HI GCNGC 5 cut(s) 83, 86, 257, 350, 473
FspBI CTAG 4 cut(s) 95, 486, 533, 579
GluI GCNGC 5 cut(s) 83, 86, 257, 350, 473
GsaI CCCAGC 1 cut(s) 479
HaeIII GGCC 2 cut(s) 215, 669
HapII CCGG 1 cut(s) 138
HgaI GACGC 1 cut(s) 624
Hin1II CATG 6 cut(s) 110, 149, 299, 311, 449, 591
HindIII AAGCTT 1 cut(s) 537
HinfI GANTC 4 cut(s) 91, 170, 582, 618
HpaII CCGG 1 cut(s) 138
HphI GGTGA 2 cut(s) 483, 617
Hpy166II GTNNAC 2 cut(s) 130, 159
Hpy188I TCNGA 7 cut(s) 42, 59, 175, 271, 293, 550, 573
Hpy188III TCNNGA 1 cut(s) 240
Hpy8I GTNNAC 2 cut(s) 130, 159
HpyAV CCTTC 3 cut(s) 58, 430, 701
HpyCH4III ACNGT 2 cut(s) 211, 629
HpyCH4IV ACGT 1 cut(s) 685
HpyCH4V TGCA 5 cut(s) 85, 110, 395, 449, 502
HpyF10VI GCNNNNNNNGC 1 cut(s) 446
HpySE526I ACGT 1 cut(s) 685
Hsp92II CATG 6 cut(s) 110, 149, 299, 311, 449, 591
Ksp22I TGATCA 1 cut(s) 103
Kzo9I GATC 5 cut(s) 9, 54, 103, 246, 271
LmnI GCTCC 2 cut(s) 165, 469
Lsp1109I GCAGC 4 cut(s) 69, 97, 361, 459
LweI GCATC 1 cut(s) 293
MaeI CTAG 4 cut(s) 95, 486, 533, 579
MaeII ACGT 1 cut(s) 685
MaeIII GTNAC 1 cut(s) 205
MalI GATC 5 cut(s) 11, 56, 105, 248, 273
MboI GATC 5 cut(s) 9, 54, 103, 246, 271
MboII GAAGA 2 cut(s) 64, 523
MluCI AATT 4 cut(s) 282, 375, 450, 653
MlyI GAGTC 2 cut(s) 85, 591
MmeI TCCRAC 2 cut(s) 316, 693
MnlI CCTC 7 cut(s) 72, 106, 460, 544, 547, 673, 691
MseI TTAA 1 cut(s) 122
MslI CAYNNNNRTG 1 cut(s) 630
MspA1I CMGCKG 1 cut(s) 88
MspCI CTTAAG 1 cut(s) 121
MspI CCGG 1 cut(s) 138
MspR9I CCNGG 1 cut(s) 217
Mva1269I GAATGC 2 cut(s) 235, 520
MvaI CCWGG 1 cut(s) 217
MwoI GCNNNNNNNGC 1 cut(s) 446
NdeII GATC 5 cut(s) 9, 54, 103, 246, 271
NlaIII CATG 6 cut(s) 110, 149, 299, 311, 449, 591
NmuCI GTSAC 1 cut(s) 205
PctI GAATGC 2 cut(s) 235, 520
PfeI GAWTC 2 cut(s) 170, 618
PflMI CCANNNNNTGG 1 cut(s) 313
PkrI GCNGC 5 cut(s) 84, 87, 258, 351, 474
PleI GAGTC 2 cut(s) 85, 590
PmaCI CACGTG 1 cut(s) 686
PmlI CACGTG 1 cut(s) 686
PpsI GAGTC 2 cut(s) 85, 590
Ppu21I YACGTR 1 cut(s) 686
Psp6I CCWGG 1 cut(s) 215
PspCI CACGTG 1 cut(s) 686
PspFI CCCAGC 1 cut(s) 475
PspGI CCWGG 1 cut(s) 215
PstI CTGCAG 1 cut(s) 87
RsaI GTAC 2 cut(s) 318, 332
RsaNI GTAC 2 cut(s) 317, 331
RseI CAYNNNNRTG 1 cut(s) 630
SaqAI TTAA 1 cut(s) 122
SatI GCNGC 5 cut(s) 83, 86, 257, 350, 473
Sau3AI GATC 5 cut(s) 9, 54, 103, 246, 271
SchI GAGTC 2 cut(s) 85, 591
ScrFI CCNGG 1 cut(s) 217
SetI ASST 8 cut(s) 186, 342, 464, 474, 491, 541, 580, 688
SfaNI GCATC 1 cut(s) 293
SfcI CTRYAG 1 cut(s) 83
SmiMI CAYNNNNRTG 1 cut(s) 630
SmlI CTYRAG 2 cut(s) 121, 593
SmoI CTYRAG 2 cut(s) 121, 593
Sse9I AATT 4 cut(s) 282, 375, 450, 653
SsiI CCGC 2 cut(s) 88, 257
SspMI CTAG 4 cut(s) 95, 486, 533, 579
StyD4I CCNGG 1 cut(s) 215
StyI CCWWGG 1 cut(s) 180
TaaI ACNGT 2 cut(s) 211, 629
TaiI ACGT 1 cut(s) 688
TasI AATT 4 cut(s) 282, 375, 450, 653
TauI GCSGC 1 cut(s) 259
TfiI GAWTC 2 cut(s) 170, 618
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
TscAI CASTG 1 cut(s) 33
TseFI GTSAC 1 cut(s) 205
TseI GCWGC 4 cut(s) 82, 85, 349, 472
Tsp45I GTSAC 1 cut(s) 205
TspDTI ATGAA 3 cut(s) 134, 324, 720
TspGWI ACGGA 2 cut(s) 144, 653
TspRI CASTG 1 cut(s) 33
Van91I CCANNNNNTGG 1 cut(s) 313
Vha464I CTTAAG 1 cut(s) 121
XapI RAATTY 1 cut(s) 653
XcmI CCANNNNNNNNNTGG 2 cut(s) 187, 452
XmiI GTMKAC 2 cut(s) 129, 158
XspI CTAG 4 cut(s) 95, 486, 533, 579
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.