Rmu_sc0000151.1_g000005

Belongs to the small heat shock protein (HSP20) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000151.1
N/A
Physical Location & Seq
Forward (+)
8257 .. 8568
312 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 312 bp
atgtcgcttatccccaatttccgacgtagcacggtagcagcaacatctttgacccccttttccctcgatctctgggaccccttcaaggattttccattcccttcttcatcgctctctctttttcccgaatttcttcgcgaaaattcggcttttgtcaacactaggatcgactggaaggaaaggttcaggcttcctgagaatgccaagatggatgaaatcagggctgctatggagaacggggttctcagcgtgactgttccaaaggcggaggtgaaaaggcctgatgttaaagccattcaaatctctggttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04141 map04141
Pfam Domains
Protein Families
HSP20

Protein Analysis

103

Amino Acids

11.72

Weight (kDa)

8.1

Isoelectric Point (pI)

53.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSP20 PF00011 57 - 102 1.2e-11 Hsp20/alpha crystallin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 138
AciI CCGC 1 cut(s) 266
AclWI GGATC 1 cut(s) 173
AcsI RAATTY 2 cut(s) 128, 142
AfiI CCNNNNNNNGG 1 cut(s) 85
AgsI TTSAA 2 cut(s) 85, 299
AlwI GGATC 1 cut(s) 173
AoxI GGCC 1 cut(s) 278
ApeKI GCWGC 2 cut(s) 38, 224
ApoI RAATTY 2 cut(s) 128, 142
Asp700I GAANNNNTTC 1 cut(s) 132
AspS9I GGNCC 1 cut(s) 76
AsuHPI GGTGA 1 cut(s) 283
AvaII GGWCC 1 cut(s) 76
BbvI GCAGC 2 cut(s) 50, 211
BccI CCATC 1 cut(s) 202
BfaI CTAG 1 cut(s) 162
BisI GCNGC 2 cut(s) 39, 225
BlsI GCNGC 2 cut(s) 40, 226
Bme18I GGWCC 1 cut(s) 76
BmgT120I GGNCC 1 cut(s) 76
BmiI GGNNCC 2 cut(s) 77, 78
Bsc4I CCNNNNNNNGG 1 cut(s) 85
Bse1I ACTGG 1 cut(s) 176
BseGI GGATG 1 cut(s) 217
BseLI CCNNNNNNNGG 1 cut(s) 85
BseMII CTCAG 2 cut(s) 186, 259
BseNI ACTGG 1 cut(s) 176
BseXI GCAGC 2 cut(s) 50, 211
Bsh1236I CGCG 1 cut(s) 138
BshFI GGCC 1 cut(s) 280
BslFI GGGAC 1 cut(s) 89
BslI CCNNNNNNNGG 1 cut(s) 85
BsmFI GGGAC 1 cut(s) 89
BsmI GAATGC 1 cut(s) 205
BsnI GGCC 1 cut(s) 280
Bsp143I GATC 2 cut(s) 67, 165
Bsp68I TCGCGA 1 cut(s) 138
BspACI CCGC 1 cut(s) 266
BspANI GGCC 1 cut(s) 280
BspCNI CTCAG 2 cut(s) 187, 258
BspFNI CGCG 1 cut(s) 138
BspLI GGNNCC 2 cut(s) 77, 78
BspPI GGATC 1 cut(s) 173
BsrI ACTGG 1 cut(s) 176
BssMI GATC 2 cut(s) 67, 165
Bst4CI ACNGT 2 cut(s) 34, 256
BstDEI CTNAG 2 cut(s) 195, 245
BstF5I GGATG 1 cut(s) 217
BstFNI CGCG 1 cut(s) 138
BstKTI GATC 2 cut(s) 70, 168
BstMBI GATC 2 cut(s) 67, 165
BstUI CGCG 1 cut(s) 138
BstV1I GCAGC 2 cut(s) 50, 211
BsuRI GGCC 1 cut(s) 280
BtgZI GCGATG 1 cut(s) 93
BtsCI GGATG 1 cut(s) 217
BtuMI TCGCGA 1 cut(s) 138
Cfr13I GGNCC 1 cut(s) 76
CviJI RGCY 5 cut(s) 149, 190, 224, 280, 293
CviKI_1 RGCY 5 cut(s) 149, 190, 224, 280, 293
DdeI CTNAG 2 cut(s) 195, 245
DpnI GATC 2 cut(s) 69, 167
DpnII GATC 2 cut(s) 67, 165
EciI GGCGGA 1 cut(s) 281
Eco147I AGGCCT 1 cut(s) 280
Eco47I GGWCC 1 cut(s) 76
EcoO109I RGGNCCY 1 cut(s) 76
FaiI YATR 1 cut(s) 230
FaqI GGGAC 1 cut(s) 89
Fnu4HI GCNGC 2 cut(s) 39, 225
FokI GGATG 1 cut(s) 224
Fsp4HI GCNGC 2 cut(s) 39, 225
FspBI CTAG 1 cut(s) 162
GluI GCNGC 2 cut(s) 39, 225
HaeIII GGCC 1 cut(s) 280
HincII GTYRAC 1 cut(s) 157
HindII GTYRAC 1 cut(s) 157
HphI GGTGA 1 cut(s) 283
Hpy166II GTNNAC 1 cut(s) 157
Hpy188I TCNGA 1 cut(s) 23
Hpy188III TCNNGA 3 cut(s) 125, 137, 194
Hpy8I GTNNAC 1 cut(s) 157
Hpy99I CGWCG 1 cut(s) 27
HpyAV CCTTC 3 cut(s) 91, 111, 169
HpyCH4III ACNGT 2 cut(s) 34, 256
HpyCH4IV ACGT 1 cut(s) 25
HpyF3I CTNAG 2 cut(s) 195, 245
HpySE526I ACGT 1 cut(s) 25
KflI GGGWCCC 1 cut(s) 76
Kzo9I GATC 2 cut(s) 67, 165
LpnPI CCDG 7 cut(s) 58, 157, 172, 205, 207, 291, 294
Lsp1109I GCAGC 2 cut(s) 50, 211
MaeI CTAG 1 cut(s) 162
MaeII ACGT 1 cut(s) 25
MaeIII GTNAC 1 cut(s) 250
MalI GATC 2 cut(s) 69, 167
MboI GATC 2 cut(s) 67, 165
MboII GAAGA 2 cut(s) 96, 125
MluCI AATT 3 cut(s) 16, 128, 142
MmeI TCCRAC 1 cut(s) 46
MnlI CCTC 2 cut(s) 74, 262
MroXI GAANNNNTTC 1 cut(s) 132
MseI TTAA 2 cut(s) 288, 310
Mva1269I GAATGC 1 cut(s) 205
MvnI CGCG 1 cut(s) 138
NdeII GATC 2 cut(s) 67, 165
NlaIV GGNNCC 2 cut(s) 77, 78
NmuCI GTSAC 1 cut(s) 250
NruI TCGCGA 1 cut(s) 138
PceI AGGCCT 1 cut(s) 280
PctI GAATGC 1 cut(s) 205
PdmI GAANNNNTTC 1 cut(s) 132
PkrI GCNGC 2 cut(s) 40, 226
PpuMI RGGWCCY 1 cut(s) 76
Psp5II RGGWCCY 1 cut(s) 76
PspN4I GGNNCC 2 cut(s) 77, 78
PspPI GGNCC 1 cut(s) 76
PspPPI RGGWCCY 1 cut(s) 76
RruI TCGCGA 1 cut(s) 138
SaqAI TTAA 2 cut(s) 288, 310
SatI GCNGC 2 cut(s) 39, 225
Sau3AI GATC 2 cut(s) 67, 165
Sau96I GGNCC 1 cut(s) 76
SetI ASST 3 cut(s) 28, 185, 273
SinI GGWCC 1 cut(s) 76
Sse9I AATT 3 cut(s) 16, 128, 142
SseBI AGGCCT 1 cut(s) 280
SsiI CCGC 1 cut(s) 266
SspMI CTAG 1 cut(s) 162
StuI AGGCCT 1 cut(s) 280
TaaI ACNGT 2 cut(s) 34, 256
TaiI ACGT 1 cut(s) 28
TaqI TCGA 2 cut(s) 66, 168
TasI AATT 3 cut(s) 16, 128, 142
Tru1I TTAA 2 cut(s) 288, 310
Tru9I TTAA 2 cut(s) 288, 310
TseFI GTSAC 1 cut(s) 250
TseI GCWGC 2 cut(s) 38, 224
Tsp45I GTSAC 1 cut(s) 250
TspDTI ATGAA 2 cut(s) 96, 228
VpaK11BI GGWCC 1 cut(s) 76
XapI RAATTY 2 cut(s) 128, 142
XmnI GAANNNNTTC 1 cut(s) 132
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.