Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000190.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

5076 .. 6053

Gene Structure 978 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 546 bp

atgaaaggaaaggtaggattaccagggaattactttgtgttgaacacaggagataaaattccagccattggacttgggacatgtcagagtggtggagacctttgtgttcaagctgtgaaagcagcattattagtagcttaccgacacatagattgtgcacatctttatggtaatgaggttgaagttagtgaggcattagctgaagcatttaaggcctgtgcgcctgtgagcttgcaactttatcgctgcccctgcagcattaccgcagcccctgctgctcgtattctctgctgcccctgcagcgtttacttcctagctgcatctgcagccttttcagagcaccaaaccggaccagtagcaacagctttctgcctaactccctgcaatattcggcagcgatcaaaattctttgctgcatcaccaccgagccatctgccacgaccaggattgcaaacagtttgcaatcctaacttaggattgaacttctaccacaatcctatctcgggatcgaacagcctccgcaatcctagattaggattgaagtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0008150 GO:0008152 GO:0016491 GO:0016701 GO:0050113 GO:0055114

KEGG Pathways

Metabolic & Signaling

ko00010 ko00040 ko00561 ko00930 ko01100 ko01110 ko01120 ko01130 ko01220 map00010 map00040 map00561 map00930 map01100 map01110 map01120 map01130 map01220

Pfam Domains

Protein Families

Aldo_ket_red

Protein Analysis

181

Amino Acids

19.15

Weight (kDa)

8.87

Isoelectric Point (pI)

39.44

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	68
AciI	CCGC	2 cut(s)	264, 520
AclWI	GGATC	1 cut(s)	514
AcsI	RAATTY	2 cut(s)	57, 404
AcuI	CTGAAG	1 cut(s)	222
AfiI	CCNNNNNNNGG	5 cut(s)	68, 443, 473, 503, 533
AflIII	ACRYGT	1 cut(s)	80
AgsI	TTSAA	5 cut(s)	43, 110, 182, 481, 541
AjnI	CCWGG	2 cut(s)	22, 442
AluBI	AGCT	6 cut(s)	113, 137, 200, 231, 317, 365
AluI	AGCT	6 cut(s)	113, 137, 200, 231, 317, 365
Alw21I	GWGCWC	2 cut(s)	160, 342
Alw26I	GTCTC	1 cut(s)	90
Alw44I	GTGCAC	1 cut(s)	156
AlwI	GGATC	1 cut(s)	514
AlwNI	CAGNNNCTG	1 cut(s)	272
Ama87I	CYCGRG	1 cut(s)	502
AoxI	GGCC	1 cut(s)	213
ApaLI	GTGCAC	1 cut(s)	156
ApoI	RAATTY	2 cut(s)	57, 404
AspLEI	GCGC	1 cut(s)	223
AspS9I	GGNCC	1 cut(s)	350
AsuHPI	GGTGA	1 cut(s)	411
AvaI	CYCGRG	1 cut(s)	502
AvaII	GGWCC	1 cut(s)	350
BaeGI	GKGCMC	1 cut(s)	160
Bbv12I	GWGCWC	2 cut(s)	160, 342
BccI	CCATC	1 cut(s)	438
BcgI	CGANNNNNNTGC	4 cut(s)	224, 258, 415, 449
BciT130I	CCWGG	2 cut(s)	24, 444
BcoDI	GTCTC	1 cut(s)	90
BfaI	CTAG	2 cut(s)	314, 528
BfmI	CTRYAG	3 cut(s)	253, 298, 324
Bme1390I	CCNGG	2 cut(s)	24, 444
Bme18I	GGWCC	1 cut(s)	350
BmeT110I	CYCGRG	1 cut(s)	502
BmgT120I	GGNCC	1 cut(s)	350
BmrFI	CCNGG	2 cut(s)	24, 444
BmsI	GCATC	2 cut(s)	329, 425
BsaI	GGTCTC	1 cut(s)	90
BsaJI	CCNNGG	1 cut(s)	23
BsaWI	WCCGGW	1 cut(s)	347
Bsc4I	CCNNNNNNNGG	5 cut(s)	68, 443, 473, 503, 533
Bse1I	ACTGG	1 cut(s)	353
BseBI	CCWGG	2 cut(s)	24, 444
BseDI	CCNNGG	1 cut(s)	23
BseLI	CCNNNNNNNGG	5 cut(s)	68, 443, 473, 503, 533
BseNI	ACTGG	1 cut(s)	353
BseSI	GKGCMC	1 cut(s)	160
BshFI	GGCC	1 cut(s)	215
BsiHKAI	GWGCWC	2 cut(s)	160, 342
BsiHKCI	CYCGRG	1 cut(s)	502
BsiSI	CCGG	1 cut(s)	348
BslFI	GGGAC	1 cut(s)	91
BslI	CCNNNNNNNGG	5 cut(s)	68, 443, 473, 503, 533
BsmAI	GTCTC	1 cut(s)	90
BsmFI	GGGAC	1 cut(s)	91
BsnI	GGCC	1 cut(s)	215
Bso31I	GGTCTC	1 cut(s)	90
BsoBI	CYCGRG	1 cut(s)	502
Bsp1286I	GDGCHC	2 cut(s)	160, 342
Bsp143I	GATC	2 cut(s)	398, 506
BspACI	CCGC	2 cut(s)	264, 520
BspANI	GGCC	1 cut(s)	215
BspMAI	CTGCAG	3 cut(s)	257, 302, 328
BspPI	GGATC	1 cut(s)	514
BspTNI	GGTCTC	1 cut(s)	90
BsrI	ACTGG	1 cut(s)	353
BssECI	CCNNGG	1 cut(s)	23
BssMI	GATC	2 cut(s)	398, 506
Bst2UI	CCWGG	2 cut(s)	24, 444
Bst4CI	ACNGT	1 cut(s)	457
BstAPI	GCANNNNNTGC	1 cut(s)	272
BstC8I	GCNNGC	1 cut(s)	233
BstDEI	CTNAG	1 cut(s)	472
BstENI	CCTNNNNNAGG	2 cut(s)	471, 531
BstHHI	GCGC	1 cut(s)	223
BstKTI	GATC	2 cut(s)	401, 509
BstMAI	GTCTC	1 cut(s)	90
BstMBI	GATC	2 cut(s)	398, 506
BstNI	CCWGG	2 cut(s)	24, 444
BstNSI	RCATGY	1 cut(s)	84
BstSCI	CCNGG	2 cut(s)	22, 442
BstSFI	CTRYAG	3 cut(s)	253, 298, 324
BstSLI	GKGCMC	1 cut(s)	160
BsuRI	GGCC	1 cut(s)	215
Cac8I	GCNNGC	1 cut(s)	233
CaiI	CAGNNNCTG	1 cut(s)	272
CfoI	GCGC	1 cut(s)	223
Cfr13I	GGNCC	1 cut(s)	350
CviAII	CATG	1 cut(s)	81
DdeI	CTNAG	1 cut(s)	472
DpnI	GATC	2 cut(s)	400, 508
DpnII	GATC	2 cut(s)	398, 506
Eco147I	AGGCCT	1 cut(s)	215
Eco31I	GGTCTC	1 cut(s)	90
Eco47I	GGWCC	1 cut(s)	350
Eco57I	CTGAAG	1 cut(s)	222
Eco88I	CYCGRG	1 cut(s)	502
EcoNI	CCTNNNNNAGG	2 cut(s)	471, 531
EcoRII	CCWGG	2 cut(s)	22, 442
FaeI	CATG	1 cut(s)	84
FaiI	YATR	3 cut(s)	82, 149, 168
FaqI	GGGAC	1 cut(s)	91
FatI	CATG	1 cut(s)	80
FspBI	CTAG	2 cut(s)	314, 528
GlaI	GCGC	1 cut(s)	222
HaeIII	GGCC	1 cut(s)	215
HapII	CCGG	1 cut(s)	348
HhaI	GCGC	1 cut(s)	223
Hin1II	CATG	1 cut(s)	84
Hin6I	GCGC	1 cut(s)	221
HinP1I	GCGC	1 cut(s)	221
HpaII	CCGG	1 cut(s)	348
HphI	GGTGA	1 cut(s)	411
Hpy166II	GTNNAC	2 cut(s)	158, 307
Hpy188I	TCNGA	2 cut(s)	87, 337
Hpy188III	TCNNGA	1 cut(s)	504
Hpy8I	GTNNAC	2 cut(s)	158, 307
HpyCH4III	ACNGT	1 cut(s)	457
HpyF3I	CTNAG	1 cut(s)	472
Hsp92II	CATG	1 cut(s)	84
HspAI	GCGC	1 cut(s)	221
Kzo9I	GATC	2 cut(s)	398, 506
LweI	GCATC	2 cut(s)	329, 425
MaeI	CTAG	2 cut(s)	314, 528
MalI	GATC	2 cut(s)	400, 508
MboI	GATC	2 cut(s)	398, 506
MhlI	GDGCHC	2 cut(s)	160, 342
MluCI	AATT	3 cut(s)	28, 57, 404
MnlI	CCTC	3 cut(s)	169, 184, 527
MseI	TTAA	1 cut(s)	210
MslI	CAYNNNNRTG	1 cut(s)	165
MspI	CCGG	1 cut(s)	348
MspR9I	CCNGG	2 cut(s)	24, 444
MvaI	CCWGG	2 cut(s)	24, 444
NdeII	GATC	2 cut(s)	398, 506
NlaIII	CATG	1 cut(s)	84
NspI	RCATGY	1 cut(s)	84
PceI	AGGCCT	1 cut(s)	215
PciI	ACATGT	1 cut(s)	80
PflMI	CCANNNNNTGG	1 cut(s)	68
PscI	ACATGT	1 cut(s)	80
Psp6I	CCWGG	2 cut(s)	22, 442
PspGI	CCWGG	2 cut(s)	22, 442
PspPI	GGNCC	1 cut(s)	350
PstI	CTGCAG	3 cut(s)	257, 302, 328
PstNI	CAGNNNCTG	1 cut(s)	272
RseI	CAYNNNNRTG	1 cut(s)	165
SaqAI	TTAA	1 cut(s)	210
Sau3AI	GATC	2 cut(s)	398, 506
Sau96I	GGNCC	1 cut(s)	350
ScrFI	CCNGG	2 cut(s)	24, 444
SduI	GDGCHC	2 cut(s)	160, 342
SetI	ASST	9 cut(s)	15, 102, 115, 139, 180, 202, 233, 319, 367
SfaNI	GCATC	2 cut(s)	329, 425
SfcI	CTRYAG	3 cut(s)	253, 298, 324
SinI	GGWCC	1 cut(s)	350
SmiMI	CAYNNNNRTG	1 cut(s)	165
Sse9I	AATT	3 cut(s)	28, 57, 404
SseBI	AGGCCT	1 cut(s)	215
SsiI	CCGC	2 cut(s)	264, 520
SspI	AATATT	1 cut(s)	388
SspMI	CTAG	2 cut(s)	314, 528
StuI	AGGCCT	1 cut(s)	215
StyD4I	CCNGG	2 cut(s)	22, 442
TaaI	ACNGT	1 cut(s)	457
TaqI	TCGA	1 cut(s)	509
TasI	AATT	3 cut(s)	28, 57, 404
Tru1I	TTAA	1 cut(s)	210
Tru9I	TTAA	1 cut(s)	210
TspDTI	ATGAA	1 cut(s)	17
Van91I	CCANNNNNTGG	1 cut(s)	68
VneI	GTGCAC	1 cut(s)	156
VpaK11BI	GGWCC	1 cut(s)	350
XagI	CCTNNNNNAGG	2 cut(s)	471, 531
XapI	RAATTY	2 cut(s)	57, 404
XceI	RCATGY	1 cut(s)	84
XspI	CTAG	2 cut(s)	314, 528

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.