Rmu_sc0000208.1_g000040

Lipase 3 N-terminal region

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000208.1
N/A
Physical Location & Seq
Forward (+)
144820 .. 146088
1269 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 585 bp
atgaccttaataggaatagtcaccgttcgccggaatccgatcaccggtggccggattcaggccacctgctgctggattccggtcgccgcccattggaatccgttcgccggaatccgatcaccggtctccggattcaggccaccggctgctggattccggtcgccgcccattggaatttctaaaaacctcaccggaaagagctgctcgactcagcccataacccattttcaccgtcgtcttaactcggacggtgtcgtcaagcgtgtcacctacgagcagacctgcagccacgcgccgccctacctcatctacgtcgaccacgaccaccgcgacatagtcctcaccatccgggggctcaatttgatgttcgacggcggctacgtccaccatgacctcttgaagtccgccatttggttgcttaactttggttttgatctttggctgtcgaaggtgaaaccatctgaaactggaatcggaatcttccgtgagagctactgtgcttctgcccatgtttcgacgacaaccactagtccaccaccggacttccaacgacgtggaccggttctgctcatctcctcgacctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lipase3_N Lipase_3

Protein Analysis

194

Amino Acids

21.45

Weight (kDa)

9.71

Isoelectric Point (pI)

45.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 74
AasI GACNNNNNNGTC 1 cut(s) 254
Acc36I ACCTGC 2 cut(s) 74, 290
AccI GTMKAC 1 cut(s) 315
AccII CGCG 2 cut(s) 293, 330
AccIII TCCGGA 1 cut(s) 128
AciI CCGC 6 cut(s) 87, 164, 296, 328, 375, 405
AcoI YGGCCR 1 cut(s) 49
AcsI RAATTY 1 cut(s) 174
AgeI ACCGGT 3 cut(s) 44, 121, 559
AgsI TTSAA 1 cut(s) 400
AhlI ACTAGT 1 cut(s) 527
AjiI CACGTC 1 cut(s) 554
AluBI AGCT 2 cut(s) 201, 492
AluI AGCT 2 cut(s) 201, 492
Alw26I GTCTC 1 cut(s) 130
Aor13HI TCCGGA 1 cut(s) 128
AoxI GGCC 3 cut(s) 49, 60, 137
ApeKI GCWGC 4 cut(s) 69, 146, 201, 285
ApoI RAATTY 1 cut(s) 174
AsiGI ACCGGT 3 cut(s) 44, 121, 559
Asp700I GAANNNNTTC 1 cut(s) 101
AspLEI GCGC 1 cut(s) 295
AspS9I GGNCC 1 cut(s) 557
AsuC2I CCSGG 1 cut(s) 350
AsuHPI GGTGA 8 cut(s) 13, 34, 111, 181, 221, 259, 334, 463
AvaII GGWCC 1 cut(s) 557
BanII GRGCYC 1 cut(s) 357
BbvI GCAGC 4 cut(s) 56, 133, 188, 297
BccI CCATC 2 cut(s) 353, 466
BceAI ACGGC 1 cut(s) 388
BcnI CCSGG 1 cut(s) 350
BcoDI GTCTC 1 cut(s) 130
BcuI ACTAGT 1 cut(s) 527
BfaI CTAG 1 cut(s) 528
BfmI CTRYAG 1 cut(s) 283
BfuAI ACCTGC 2 cut(s) 74, 290
BisI GCNGC 8 cut(s) 70, 87, 147, 164, 202, 286, 296, 376
BlsI GCNGC 8 cut(s) 71, 88, 148, 165, 203, 287, 297, 377
Bme1390I CCNGG 1 cut(s) 350
Bme18I GGWCC 1 cut(s) 557
BmgBI CACGTC 1 cut(s) 554
BmgT120I GGNCC 1 cut(s) 557
BmrFI CCNGG 1 cut(s) 350
BpuMI CCSGG 1 cut(s) 350
BsaI GGTCTC 1 cut(s) 130
BsaJI CCNNGG 1 cut(s) 349
BsaWI WCCGGW 8 cut(s) 44, 79, 121, 128, 156, 191, 538, 559
Bse118I RCCGGY 4 cut(s) 44, 121, 142, 559
Bse1I ACTGG 1 cut(s) 472
BseAI TCCGGA 1 cut(s) 128
BseDI CCNNGG 1 cut(s) 349
BseGI GGATG 1 cut(s) 345
BseMII CTCAG 1 cut(s) 224
BseNI ACTGG 1 cut(s) 472
BseRI GAGGAG 1 cut(s) 565
BseXI GCAGC 4 cut(s) 56, 133, 188, 297
Bsh1236I CGCG 2 cut(s) 293, 330
Bsh1285I CGRYCG 2 cut(s) 84, 161
BshFI GGCC 3 cut(s) 51, 62, 139
BshTI ACCGGT 3 cut(s) 44, 121, 559
BsiEI CGRYCG 2 cut(s) 84, 161
BsmAI GTCTC 1 cut(s) 130
BsnI GGCC 3 cut(s) 51, 62, 139
Bso31I GGTCTC 1 cut(s) 130
Bsp1286I GDGCHC 1 cut(s) 357
Bsp13I TCCGGA 1 cut(s) 128
Bsp143I GATC 3 cut(s) 39, 116, 433
BspACI CCGC 6 cut(s) 87, 164, 296, 328, 375, 405
BspANI GGCC 3 cut(s) 51, 62, 139
BspCNI CTCAG 1 cut(s) 223
BspEI TCCGGA 1 cut(s) 128
BspFNI CGCG 2 cut(s) 293, 330
BspMAI CTGCAG 1 cut(s) 287
BspMI ACCTGC 2 cut(s) 74, 290
BspTNI GGTCTC 1 cut(s) 130
BsrFI RCCGGY 4 cut(s) 44, 121, 142, 559
BsrI ACTGG 1 cut(s) 472
BssAI RCCGGY 4 cut(s) 44, 121, 142, 559
BssECI CCNNGG 1 cut(s) 349
BssMI GATC 3 cut(s) 39, 116, 433
Bst4CI ACNGT 4 cut(s) 25, 233, 251, 497
BstDEI CTNAG 1 cut(s) 210
BstF5I GGATG 1 cut(s) 345
BstFNI CGCG 2 cut(s) 293, 330
BstHHI GCGC 1 cut(s) 295
BstKTI GATC 3 cut(s) 42, 119, 436
BstMAI GTCTC 1 cut(s) 130
BstMBI GATC 3 cut(s) 39, 116, 433
BstMCI CGRYCG 2 cut(s) 84, 161
BstSCI CCNGG 1 cut(s) 348
BstSFI CTRYAG 1 cut(s) 283
BstUI CGCG 2 cut(s) 293, 330
BstV1I GCAGC 4 cut(s) 56, 133, 188, 297
BstXI CCANNNNNNTGG 1 cut(s) 554
BsuRI GGCC 3 cut(s) 51, 62, 139
BtrI CACGTC 1 cut(s) 554
BtsCI GGATG 1 cut(s) 345
BveI ACCTGC 2 cut(s) 74, 290
CfoI GCGC 1 cut(s) 295
Cfr10I RCCGGY 4 cut(s) 44, 121, 142, 559
Cfr13I GGNCC 1 cut(s) 557
CspAI ACCGGT 3 cut(s) 44, 121, 559
CviAII CATG 2 cut(s) 389, 509
DdeI CTNAG 1 cut(s) 210
DpnI GATC 3 cut(s) 41, 118, 435
DpnII GATC 3 cut(s) 39, 116, 433
DrdI GACNNNNNNGTC 1 cut(s) 254
DseDI GACNNNNNNGTC 1 cut(s) 254
EaeI YGGCCR 1 cut(s) 49
EciI GGCGGA 1 cut(s) 394
Eco24I GRGCYC 1 cut(s) 357
Eco31I GGTCTC 1 cut(s) 130
Eco47I GGWCC 1 cut(s) 557
EcoT38I GRGCYC 1 cut(s) 357
FaeI CATG 2 cut(s) 392, 512
FaiI YATR 4 cut(s) 218, 335, 390, 510
FatI CATG 2 cut(s) 388, 508
FblI GTMKAC 1 cut(s) 315
Fnu4HI GCNGC 8 cut(s) 70, 87, 147, 164, 202, 286, 296, 376
FokI GGATG 1 cut(s) 332
FriOI GRGCYC 1 cut(s) 357
Fsp4HI GCNGC 8 cut(s) 70, 87, 147, 164, 202, 286, 296, 376
FspBI CTAG 1 cut(s) 528
GlaI GCGC 1 cut(s) 294
GluI GCNGC 8 cut(s) 70, 87, 147, 164, 202, 286, 296, 376
HaeIII GGCC 3 cut(s) 51, 62, 139
HhaI GCGC 1 cut(s) 295
Hin1II CATG 2 cut(s) 392, 512
Hin6I GCGC 1 cut(s) 293
HinP1I GCGC 1 cut(s) 293
HincII GTYRAC 1 cut(s) 316
HindII GTYRAC 1 cut(s) 316
HphI GGTGA 8 cut(s) 13, 34, 111, 181, 221, 259, 334, 463
Hpy166II GTNNAC 4 cut(s) 316, 385, 533, 557
Hpy188I TCNGA 5 cut(s) 39, 116, 247, 463, 476
Hpy188III TCNNGA 2 cut(s) 129, 397
Hpy8I GTNNAC 4 cut(s) 316, 385, 533, 557
Hpy99I CGWCG 5 cut(s) 237, 317, 374, 520, 555
HpyAV CCTTC 1 cut(s) 442
HpyCH4III ACNGT 4 cut(s) 25, 233, 251, 497
HpyCH4IV ACGT 3 cut(s) 312, 381, 553
HpyCH4V TGCA 1 cut(s) 285
HpyF3I CTNAG 1 cut(s) 210
HpySE526I ACGT 3 cut(s) 312, 381, 553
Hsp92II CATG 2 cut(s) 392, 512
HspAI GCGC 1 cut(s) 293
Kpn2I TCCGGA 1 cut(s) 128
Kzo9I GATC 3 cut(s) 39, 116, 433
Lsp1109I GCAGC 4 cut(s) 56, 133, 188, 297
MaeI CTAG 1 cut(s) 528
MaeII ACGT 3 cut(s) 312, 381, 553
MaeIII GTNAC 2 cut(s) 19, 265
MalI GATC 3 cut(s) 41, 118, 435
MboI GATC 3 cut(s) 39, 116, 433
MboII GAAGA 1 cut(s) 472
MhlI GDGCHC 1 cut(s) 357
MluCI AATT 2 cut(s) 174, 358
MlyI GAGTC 1 cut(s) 202
MmeI TCCRAC 1 cut(s) 571
MnlI CCTC 4 cut(s) 197, 314, 350, 404
MroI TCCGGA 1 cut(s) 128
MroXI GAANNNNTTC 1 cut(s) 101
MseI TTAA 3 cut(s) 8, 240, 420
MspR9I CCNGG 1 cut(s) 350
MvnI CGCG 2 cut(s) 293, 330
NciI CCSGG 1 cut(s) 350
NdeII GATC 3 cut(s) 39, 116, 433
NlaIII CATG 2 cut(s) 392, 512
NmuCI GTSAC 2 cut(s) 19, 265
PaqCI CACCTGC 1 cut(s) 74
PcsI WCGNNNNNNNCGW 3 cut(s) 318, 327, 378
PdmI GAANNNNTTC 1 cut(s) 101
PfeI GAWTC 9 cut(s) 34, 55, 76, 97, 111, 132, 153, 471, 477
PflFI GACNNNGTC 2 cut(s) 251, 335
PinAI ACCGGT 3 cut(s) 44, 121, 559
PkrI GCNGC 8 cut(s) 71, 88, 148, 165, 203, 287, 297, 377
PleI GAGTC 1 cut(s) 202
PpsI GAGTC 1 cut(s) 202
PspPI GGNCC 1 cut(s) 557
PstI CTGCAG 1 cut(s) 287
PsyI GACNNNGTC 2 cut(s) 251, 335
SalI GTCGAC 1 cut(s) 314
SaqAI TTAA 3 cut(s) 8, 240, 420
SatI GCNGC 8 cut(s) 70, 87, 147, 164, 202, 286, 296, 376
Sau3AI GATC 3 cut(s) 39, 116, 433
Sau96I GGNCC 1 cut(s) 557
SchI GAGTC 1 cut(s) 202
ScrFI CCNGG 1 cut(s) 350
SduI GDGCHC 1 cut(s) 357
SfcI CTRYAG 1 cut(s) 283
SgrAI CRCCGGYG 1 cut(s) 44
SinI GGWCC 1 cut(s) 557
SpeI ACTAGT 1 cut(s) 527
Sse9I AATT 2 cut(s) 174, 358
SsiI CCGC 6 cut(s) 87, 164, 296, 328, 375, 405
SspMI CTAG 1 cut(s) 528
StyD4I CCNGG 1 cut(s) 348
TaaI ACNGT 4 cut(s) 25, 233, 251, 497
TaiI ACGT 3 cut(s) 315, 384, 556
TaqI TCGA 6 cut(s) 206, 315, 369, 446, 515, 578
TasI AATT 2 cut(s) 174, 358
TauI GCSGC 4 cut(s) 89, 166, 298, 378
TfiI GAWTC 9 cut(s) 34, 55, 76, 97, 111, 132, 153, 471, 477
Tru1I TTAA 3 cut(s) 8, 240, 420
Tru9I TTAA 3 cut(s) 8, 240, 420
TseFI GTSAC 2 cut(s) 19, 265
TseI GCWGC 4 cut(s) 69, 146, 201, 285
Tsp45I GTSAC 2 cut(s) 19, 265
TspGWI ACGGA 2 cut(s) 90, 473
Tth111I GACNNNGTC 2 cut(s) 251, 335
VpaK11BI GGWCC 1 cut(s) 557
XapI RAATTY 1 cut(s) 174
XmiI GTMKAC 1 cut(s) 315
XmnI GAANNNNTTC 1 cut(s) 101
XspI CTAG 1 cut(s) 528
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.