Rmu_sc0000224.1_g000001

RRP12-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000224.1
OG0031050
Physical Location & Seq
Reverse (-)
2 .. 1076
1075 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 578 bp
atggaggaagagcaccaccacgaccaccacgacgccgaggccgagccgttcaaagatggcgcagacatctgccaacagctcatggaccgctactccaagtcctcggcgccgcagcaccaccacctcctcgccaccgccgccgcaatgcgctccatcctcgacgccgagtccctccccctcaccccgccctcctacttcgccgccaccatctccgccatcgacgacatgtcgtcccagaccacggaccctaccgccgtagctgcgctgctgtcgtttctgtccctggtgctcccgctggtgccgcctcggagcatctcgtcggccaaggcgggtgaggcgctgtcgatgctggtggagcttctggaaagagaggagggccggctgacgatgaccggcgttaaggctgtggtcaagtgcttgggtgctttggttggcttttgtgatttggaggattgggaatccatcaaattggggctgcagacattgctcaagttctccgttgataaaagacctaaggtccgcaaatgttcgcaagactgtcttgagaatgtatttaagtcactccagtcccgcagtgt
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NUC173

Protein Analysis

193

Amino Acids

21.13

Weight (kDa)

5.44

Isoelectric Point (pI)

47.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HEAT_RRP12_N PF25772 11 - 192 4.3e-76 RRP12-like, N-terminal HEAT repeats
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0031050)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000224.1_g000001 Rmu_sc0014410.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 106, 298
AcoI YGGCCR 1 cut(s) 321
AcyI GRCGYC 3 cut(s) 33, 107, 162
AfiI CCNNNNNNNGG 1 cut(s) 241
AflIII ACRYGT 1 cut(s) 225
AgsI TTSAA 1 cut(s) 52
AhdI GACNNNNNGTC 4 cut(s) 166, 226, 229, 515
AjnI CCWGG 1 cut(s) 282
AluBI AGCT 3 cut(s) 79, 260, 358
AluI AGCT 3 cut(s) 79, 260, 358
Alw21I GWGCWC 2 cut(s) 15, 291
AoxI GGCC 3 cut(s) 39, 321, 376
ApeKI GCWGC 4 cut(s) 112, 260, 265, 475
AspLEI GCGC 5 cut(s) 62, 109, 150, 265, 340
AspS9I GGNCC 4 cut(s) 85, 244, 376, 517
AsuHPI GGTGA 2 cut(s) 172, 344
AvaII GGWCC 3 cut(s) 85, 244, 517
AxyI CCTNAGG 1 cut(s) 513
BanI GGYRCC 2 cut(s) 106, 298
Bbv12I GWGCWC 2 cut(s) 15, 291
BbvI GCAGC 4 cut(s) 124, 247, 252, 462
BccI CCATC 5 cut(s) 50, 161, 215, 224, 470
BceAI ACGGC 2 cut(s) 31, 239
BciT130I CCWGG 1 cut(s) 284
BfmI CTRYAG 1 cut(s) 476
BfoI RGCGCY 2 cut(s) 110, 341
BisI GCNGC 9 cut(s) 110, 113, 138, 141, 201, 261, 266, 302, 476
BlsI GCNGC 9 cut(s) 111, 114, 139, 142, 202, 262, 267, 303, 477
Bme1390I CCNGG 1 cut(s) 284
Bme18I GGWCC 3 cut(s) 85, 244, 517
BmeRI GACNNNNNGTC 4 cut(s) 166, 226, 229, 515
BmgT120I GGNCC 4 cut(s) 85, 244, 376, 517
BmiI GGNNCC 3 cut(s) 108, 246, 300
BmrFI CCNGG 1 cut(s) 284
BmsI GCATC 2 cut(s) 321, 336
BpmI CTGGAG 1 cut(s) 548
BpuEI CTTGAG 2 cut(s) 473, 563
BsaHI GRCGYC 3 cut(s) 33, 107, 162
BsaJI CCNNGG 6 cut(s) 36, 102, 240, 282, 305, 324
BsaXI ACNNNNNCTCC 2 cut(s) 77, 107
Bsc4I CCNNNNNNNGG 1 cut(s) 241
Bse118I RCCGGY 2 cut(s) 378, 392
Bse1I ACTGG 1 cut(s) 565
Bse21I CCTNAGG 1 cut(s) 513
Bse3DI GCAATG 2 cut(s) 150, 482
BseBI CCWGG 1 cut(s) 284
BseDI CCNNGG 6 cut(s) 36, 102, 240, 282, 305, 324
BseGI GGATG 1 cut(s) 153
BseLI CCNNNNNNNGG 1 cut(s) 241
BseMI GCAATG 2 cut(s) 150, 482
BseNI ACTGG 1 cut(s) 565
BseRI GAGGAG 2 cut(s) 116, 386
BseXI GCAGC 4 cut(s) 124, 247, 252, 462
BshFI GGCC 3 cut(s) 41, 323, 378
BshNI GGYRCC 2 cut(s) 106, 298
BsiHKAI GWGCWC 2 cut(s) 15, 291
BsiSI CCGG 2 cut(s) 379, 393
BslFI GGGAC 4 cut(s) 154, 217, 265, 553
BslI CCNNNNNNNGG 1 cut(s) 241
BsmFI GGGAC 4 cut(s) 154, 217, 265, 553
BsnI GGCC 3 cut(s) 41, 323, 378
Bsp1286I GDGCHC 2 cut(s) 15, 291
BspANI GGCC 3 cut(s) 41, 323, 378
BspLI GGNNCC 3 cut(s) 108, 246, 300
BspMAI CTGCAG 1 cut(s) 480
BspQI GCTCTTC 1 cut(s) 3
BspT107I GGYRCC 2 cut(s) 106, 298
BsrDI GCAATG 2 cut(s) 150, 482
BsrFI RCCGGY 2 cut(s) 378, 392
BsrI ACTGG 1 cut(s) 565
BssAI RCCGGY 2 cut(s) 378, 392
BssECI CCNNGG 6 cut(s) 36, 102, 240, 282, 305, 324
BssNI GRCGYC 3 cut(s) 33, 107, 162
BssT1I CCWWGG 1 cut(s) 324
Bst2UI CCWGG 1 cut(s) 284
Bst4CI ACNGT 1 cut(s) 539
Bst6I CTCTTC 1 cut(s) 3
BstACI GRCGYC 3 cut(s) 33, 107, 162
BstAPI GCANNNNNTGC 1 cut(s) 484
BstC8I GCNNGC 1 cut(s) 380
BstDEI CTNAG 1 cut(s) 513
BstDSI CCRYGG 1 cut(s) 240
BstF5I GGATG 1 cut(s) 153
BstH2I RGCGCY 2 cut(s) 110, 341
BstHHI GCGC 5 cut(s) 62, 109, 150, 265, 340
BstMWI GCNNNNNNNGC 7 cut(s) 137, 260, 301, 335, 346, 355, 484
BstNI CCWGG 1 cut(s) 284
BstNSI RCATGY 1 cut(s) 229
BstSCI CCNGG 1 cut(s) 282
BstSFI CTRYAG 1 cut(s) 476
BstV1I GCAGC 4 cut(s) 124, 247, 252, 462
BstXI CCANNNNNNTGG 1 cut(s) 469
Bsu36I CCTNAGG 1 cut(s) 513
BsuRI GGCC 3 cut(s) 41, 323, 378
BtgI CCRYGG 1 cut(s) 240
BtsCI GGATG 1 cut(s) 153
Cac8I GCNNGC 1 cut(s) 380
CfoI GCGC 5 cut(s) 62, 109, 150, 265, 340
Cfr10I RCCGGY 2 cut(s) 378, 392
Cfr13I GGNCC 4 cut(s) 85, 244, 376, 517
CseI GACGC 2 cut(s) 41, 170
CviAII CATG 2 cut(s) 82, 226
DdeI CTNAG 1 cut(s) 513
DinI GGCGCC 1 cut(s) 108
DriI GACNNNNNGTC 4 cut(s) 166, 226, 229, 515
EaeI YGGCCR 1 cut(s) 321
Eam1104I CTCTTC 1 cut(s) 3
Eam1105I GACNNNNNGTC 4 cut(s) 166, 226, 229, 515
EarI CTCTTC 1 cut(s) 3
EciI GGCGGA 1 cut(s) 202
Eco130I CCWWGG 1 cut(s) 324
Eco47I GGWCC 3 cut(s) 85, 244, 517
Eco81I CCTNAGG 1 cut(s) 513
EcoRII CCWGG 1 cut(s) 282
EcoT14I CCWWGG 1 cut(s) 324
EgeI GGCGCC 1 cut(s) 108
EheI GGCGCC 1 cut(s) 108
ErhI CCWWGG 1 cut(s) 324
FaeI CATG 2 cut(s) 85, 229
FaiI YATR 2 cut(s) 83, 227
FalI AAGNNNNNCTT 2 cut(s) 525, 557
FaqI GGGAC 4 cut(s) 154, 217, 265, 553
FatI CATG 2 cut(s) 81, 225
FauI CCCGC 3 cut(s) 192, 300, 322
Fnu4HI GCNGC 9 cut(s) 110, 113, 138, 141, 201, 261, 266, 302, 476
FokI GGATG 1 cut(s) 140
Fsp4HI GCNGC 9 cut(s) 110, 113, 138, 141, 201, 261, 266, 302, 476
GlaI GCGC 5 cut(s) 61, 108, 149, 264, 339
GluI GCNGC 9 cut(s) 110, 113, 138, 141, 201, 261, 266, 302, 476
GsuI CTGGAG 1 cut(s) 548
HaeII RGCGCY 2 cut(s) 110, 341
HaeIII GGCC 3 cut(s) 41, 323, 378
HapII CCGG 2 cut(s) 379, 393
HgaI GACGC 2 cut(s) 41, 170
HhaI GCGC 5 cut(s) 62, 109, 150, 265, 340
Hin1I GRCGYC 3 cut(s) 33, 107, 162
Hin1II CATG 2 cut(s) 85, 229
Hin6I GCGC 5 cut(s) 60, 107, 148, 263, 338
HinP1I GCGC 5 cut(s) 60, 107, 148, 263, 338
HinfI GANTC 2 cut(s) 167, 458
HpaII CCGG 2 cut(s) 379, 393
HphI GGTGA 2 cut(s) 172, 344
Hpy188I TCNGA 1 cut(s) 309
Hpy188III TCNNGA 2 cut(s) 362, 542
Hpy99I CGWCG 4 cut(s) 35, 164, 224, 322
HpyCH4III ACNGT 1 cut(s) 539
HpyCH4V TGCA 1 cut(s) 478
HpyF10VI GCNNNNNNNGC 7 cut(s) 137, 260, 301, 335, 346, 355, 484
HpyF3I CTNAG 1 cut(s) 513
Hsp92I GRCGYC 3 cut(s) 33, 107, 162
Hsp92II CATG 2 cut(s) 85, 229
HspAI GCGC 5 cut(s) 60, 107, 148, 263, 338
KasI GGCGCC 1 cut(s) 106
KroI GCCGGC 1 cut(s) 378
KroNI GCCGGC 1 cut(s) 380
LguI GCTCTTC 1 cut(s) 3
LmnI GCTCC 4 cut(s) 155, 294, 309, 355
LpnPI CCDG 8 cut(s) 248, 269, 281, 296, 335, 347, 392, 406
Lsp1109I GCAGC 4 cut(s) 124, 247, 252, 462
LweI GCATC 2 cut(s) 321, 336
MaeIII GTNAC 1 cut(s) 558
MboII GAAGA 1 cut(s) 20
MhlI GDGCHC 2 cut(s) 15, 291
MluCI AATT 1 cut(s) 467
Mly113I GGCGCC 1 cut(s) 107
MlyI GAGTC 1 cut(s) 176
MroNI GCCGGC 1 cut(s) 378
MseI TTAA 2 cut(s) 399, 555
MspA1I CMGCKG 1 cut(s) 295
MspI CCGG 2 cut(s) 379, 393
MspR9I CCNGG 1 cut(s) 284
MvaI CCWGG 1 cut(s) 284
MwoI GCNNNNNNNGC 7 cut(s) 137, 260, 301, 335, 346, 355, 484
NaeI GCCGGC 1 cut(s) 380
NarI GGCGCC 1 cut(s) 107
NgoMIV GCCGGC 1 cut(s) 378
NlaIII CATG 2 cut(s) 85, 229
NlaIV GGNNCC 3 cut(s) 108, 246, 300
NmeAIII GCCGAG 4 cut(s) 61, 67, 83, 190
NmuCI GTSAC 1 cut(s) 558
NspI RCATGY 1 cut(s) 229
PciI ACATGT 1 cut(s) 225
PciSI GCTCTTC 1 cut(s) 3
PcsI WCGNNNNNNNCGW 2 cut(s) 27, 39
PdiI GCCGGC 1 cut(s) 380
PfeI GAWTC 1 cut(s) 458
PkrI GCNGC 9 cut(s) 111, 114, 139, 142, 202, 262, 267, 303, 477
PleI GAGTC 1 cut(s) 175
PluTI GGCGCC 1 cut(s) 110
PpsI GAGTC 1 cut(s) 175
PscI ACATGT 1 cut(s) 225
Psp6I CCWGG 1 cut(s) 282
PspGI CCWGG 1 cut(s) 282
PspN4I GGNNCC 3 cut(s) 108, 246, 300
PspPI GGNCC 4 cut(s) 85, 244, 376, 517
PstI CTGCAG 1 cut(s) 480
SapI GCTCTTC 1 cut(s) 3
SaqAI TTAA 2 cut(s) 399, 555
SatI GCNGC 9 cut(s) 110, 113, 138, 141, 201, 261, 266, 302, 476
Sau96I GGNCC 4 cut(s) 85, 244, 376, 517
SchI GAGTC 1 cut(s) 176
ScrFI CCNGG 1 cut(s) 284
SduI GDGCHC 2 cut(s) 15, 291
SetI ASST 6 cut(s) 81, 126, 262, 360, 514, 519
SfaNI GCATC 2 cut(s) 321, 336
SfcI CTRYAG 1 cut(s) 476
SfoI GGCGCC 1 cut(s) 108
SinI GGWCC 3 cut(s) 85, 244, 517
SmlI CTYRAG 2 cut(s) 488, 542
SmoI CTYRAG 2 cut(s) 488, 542
Sse9I AATT 1 cut(s) 467
SspDI GGCGCC 1 cut(s) 106
StyD4I CCNGG 1 cut(s) 282
StyI CCWWGG 1 cut(s) 324
TaaI ACNGT 1 cut(s) 539
TaqI TCGA 3 cut(s) 159, 219, 344
TasI AATT 1 cut(s) 467
TauI GCSGC 5 cut(s) 112, 140, 143, 203, 304
TfiI GAWTC 1 cut(s) 458
Tru1I TTAA 2 cut(s) 399, 555
Tru9I TTAA 2 cut(s) 399, 555
TseFI GTSAC 1 cut(s) 558
TseI GCWGC 4 cut(s) 112, 260, 265, 475
Tsp45I GTSAC 1 cut(s) 558
TspGWI ACGGA 2 cut(s) 257, 487
VpaK11BI GGWCC 3 cut(s) 85, 244, 517
XceI RCATGY 1 cut(s) 229
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.