Rmu_sc0000243.1_g000012

Late embryogenesis abundant protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000243.1
N/A
Physical Location & Seq
Forward (+)
56739 .. 59192
2454 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 666 bp
atggctgagaagactcaccaggtttatcctatagccccaacaaatggttacacaagaagtgatggagaatctttggtatctaaagatgggctgaagcgcaaaaagagaatcgagttttttacctacattgctactttcattgttgtccaaactcttaactccgtccctgcaacaccatcattctatgcaatgttcacaacccaaattaggatcaagaacacaaattggggtccatacaagtttgatgcaggtagtgccacatttctgtaccaaggagtgactattgggcaggttgtgattcctaagagcaaggcaggaatgcgttccaccaagaagattaatgtagaggtcagcgtgaatactaatgcaatgccgagcagttctacacttggcagtgaattgaacagtgggtcacttctagaccggttcttgaggctctgcttccggttcctgaatccttccgttgaggcactgccgttgactgagtttggaggccgtagacagtctggaaggagtcgaaccggtggaggatttacggcagacgatttggagcttccgaaggccggttctggcgggtctgtcgcctgttctggaatcctggggtctaaggctttaaggtgtgtggtggaggtagaaagggtttcaagcttttgtattcggatttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LEA_2

Protein Analysis

221

Amino Acids

24.0

Weight (kDa)

9.81

Isoelectric Point (pI)

42.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 239, 280
AccB7I CCANNNNNTGG 1 cut(s) 44
AccI GTMKAC 1 cut(s) 499
AciI CCGC 1 cut(s) 573
AclWI GGATC 1 cut(s) 218
AcuI CTGAAG 1 cut(s) 113
AfaI GTAC 1 cut(s) 269
AfiI CCNNNNNNNGG 3 cut(s) 44, 207, 563
AgeI ACCGGT 2 cut(s) 423, 521
AgsI TTSAA 2 cut(s) 403, 645
AjnI CCWGG 2 cut(s) 18, 597
AluBI AGCT 2 cut(s) 553, 648
AluI AGCT 2 cut(s) 553, 648
AlwI GGATC 1 cut(s) 218
AoxI GGCC 2 cut(s) 493, 561
AseI ATTAAT 1 cut(s) 339
AsiGI ACCGGT 2 cut(s) 423, 521
Asp700I GAANNNNTTC 1 cut(s) 322
AspLEI GCGC 1 cut(s) 99
AspS9I GGNCC 1 cut(s) 230
AsuHPI GGTGA 1 cut(s) 8
AvaII GGWCC 1 cut(s) 230
BbsI GAAGAC 1 cut(s) 17
BccI CCATC 3 cut(s) 56, 80, 184
BceAI ACGGC 3 cut(s) 460, 480, 552
BciT130I CCWGG 2 cut(s) 20, 599
BfaI CTAG 1 cut(s) 419
BfmI CTRYAG 1 cut(s) 30
BfuAI ACCTGC 2 cut(s) 239, 280
Bme1390I CCNGG 2 cut(s) 20, 599
Bme18I GGWCC 1 cut(s) 230
BmgT120I GGNCC 1 cut(s) 230
BmiI GGNNCC 2 cut(s) 231, 449
BmrFI CCNGG 2 cut(s) 20, 599
BmsI GCATC 1 cut(s) 235
BpiI GAAGAC 1 cut(s) 17
BpuEI CTTGAG 1 cut(s) 451
BsaJI CCNNGG 2 cut(s) 271, 598
BsaWI WCCGGW 3 cut(s) 423, 444, 521
Bsc4I CCNNNNNNNGG 3 cut(s) 44, 207, 563
Bse118I RCCGGY 3 cut(s) 423, 521, 563
Bse3DI GCAATG 3 cut(s) 126, 195, 375
BseBI CCWGG 2 cut(s) 20, 599
BseDI CCNNGG 2 cut(s) 271, 598
BseLI CCNNNNNNNGG 3 cut(s) 44, 207, 563
BseMI GCAATG 3 cut(s) 126, 195, 375
BseMII CTCAG 1 cut(s) 474
BshFI GGCC 2 cut(s) 495, 563
BshTI ACCGGT 2 cut(s) 423, 521
BsiSI CCGG 4 cut(s) 424, 445, 522, 564
BslFI GGGAC 1 cut(s) 149
BslI CCNNNNNNNGG 3 cut(s) 44, 207, 563
BsmFI GGGAC 1 cut(s) 149
BsmI GAATGC 1 cut(s) 324
BsnI GGCC 2 cut(s) 495, 563
Bsp143I GATC 1 cut(s) 210
BspACI CCGC 1 cut(s) 573
BspANI GGCC 2 cut(s) 495, 563
BspCNI CTCAG 1 cut(s) 475
BspLI GGNNCC 2 cut(s) 231, 449
BspMI ACCTGC 2 cut(s) 239, 280
BspPI GGATC 1 cut(s) 218
BsrDI GCAATG 3 cut(s) 126, 195, 375
BsrFI RCCGGY 3 cut(s) 423, 521, 563
BssAI RCCGGY 3 cut(s) 423, 521, 563
BssECI CCNNGG 2 cut(s) 271, 598
BssMI GATC 1 cut(s) 210
BssT1I CCWWGG 1 cut(s) 271
Bst2UI CCWGG 2 cut(s) 20, 599
Bst4CI ACNGT 2 cut(s) 407, 504
BstAPI GCANNNNNTGC 1 cut(s) 254
BstDEI CTNAG 4 cut(s) 6, 303, 483, 606
BstHHI GCGC 1 cut(s) 99
BstKTI GATC 1 cut(s) 213
BstMBI GATC 1 cut(s) 210
BstMWI GCNNNNNNNGC 1 cut(s) 254
BstNI CCWGG 2 cut(s) 20, 599
BstSCI CCNGG 2 cut(s) 18, 597
BstSFI CTRYAG 1 cut(s) 30
BstV2I GAAGAC 1 cut(s) 17
BsuRI GGCC 2 cut(s) 495, 563
BtsI GCAGTG 2 cut(s) 400, 470
BtsIMutI CAGTG 3 cut(s) 400, 412, 470
BveI ACCTGC 2 cut(s) 239, 280
CfoI GCGC 1 cut(s) 99
Cfr10I RCCGGY 3 cut(s) 423, 521, 563
Cfr13I GGNCC 1 cut(s) 230
CsiI ACCWGGT 1 cut(s) 18
Csp6I GTAC 1 cut(s) 268
CspAI ACCGGT 2 cut(s) 423, 521
CviJI RGCY 9 cut(s) 5, 35, 91, 436, 495, 553, 563, 611, 648
CviKI_1 RGCY 9 cut(s) 5, 35, 91, 436, 495, 553, 563, 611, 648
CviQI GTAC 1 cut(s) 268
DdeI CTNAG 4 cut(s) 6, 303, 483, 606
DpnI GATC 1 cut(s) 212
DpnII GATC 1 cut(s) 210
Eco130I CCWWGG 1 cut(s) 271
Eco47I GGWCC 1 cut(s) 230
Eco57I CTGAAG 1 cut(s) 113
EcoRII CCWGG 2 cut(s) 18, 597
EcoT14I CCWWGG 1 cut(s) 271
ErhI CCWWGG 1 cut(s) 271
FaiI YATR 3 cut(s) 32, 186, 235
FaqI GGGAC 1 cut(s) 149
FauI CCCGC 1 cut(s) 566
FblI GTMKAC 1 cut(s) 499
FspBI CTAG 1 cut(s) 419
GlaI GCGC 1 cut(s) 98
HaeIII GGCC 2 cut(s) 495, 563
HapII CCGG 4 cut(s) 424, 445, 522, 564
HhaI GCGC 1 cut(s) 99
Hin6I GCGC 1 cut(s) 97
HinP1I GCGC 1 cut(s) 97
HincII GTYRAC 1 cut(s) 480
HindII GTYRAC 1 cut(s) 480
HindIII AAGCTT 1 cut(s) 646
HinfI GANTC 7 cut(s) 13, 68, 108, 298, 454, 514, 594
HpaII CCGG 4 cut(s) 424, 445, 522, 564
HphI GGTGA 1 cut(s) 8
Hpy166II GTNNAC 3 cut(s) 195, 480, 500
Hpy188I TCNGA 2 cut(s) 558, 660
Hpy188III TCNNGA 6 cut(s) 214, 419, 430, 451, 507, 591
Hpy8I GTNNAC 3 cut(s) 195, 480, 500
HpyAV CCTTC 3 cut(s) 468, 504, 553
HpyCH4III ACNGT 2 cut(s) 407, 504
HpyCH4V TGCA 4 cut(s) 170, 188, 248, 368
HpyF10VI GCNNNNNNNGC 1 cut(s) 254
HpyF3I CTNAG 4 cut(s) 6, 303, 483, 606
HspAI GCGC 1 cut(s) 97
Kzo9I GATC 1 cut(s) 210
LmnI GCTCC 1 cut(s) 550
LweI GCATC 1 cut(s) 235
MabI ACCWGGT 1 cut(s) 18
MaeI CTAG 1 cut(s) 419
MaeIII GTNAC 3 cut(s) 47, 277, 411
MalI GATC 1 cut(s) 212
MboI GATC 1 cut(s) 210
MboII GAAGA 2 cut(s) 22, 346
MluCI AATT 3 cut(s) 204, 223, 398
MlyI GAGTC 2 cut(s) 7, 523
MnlI CCTC 6 cut(s) 340, 426, 460, 485, 521, 622
MroXI GAANNNNTTC 1 cut(s) 322
MseI TTAA 3 cut(s) 156, 339, 614
MspI CCGG 4 cut(s) 424, 445, 522, 564
MspR9I CCNGG 2 cut(s) 20, 599
Mva1269I GAATGC 1 cut(s) 324
MvaI CCWGG 2 cut(s) 20, 599
MwoI GCNNNNNNNGC 1 cut(s) 254
NdeII GATC 1 cut(s) 210
NlaIV GGNNCC 2 cut(s) 231, 449
NmeAIII GCCGAG 1 cut(s) 399
NmuCI GTSAC 2 cut(s) 277, 411
PctI GAATGC 1 cut(s) 324
PdmI GAANNNNTTC 1 cut(s) 322
PfeI GAWTC 5 cut(s) 68, 108, 298, 454, 594
PflMI CCANNNNNTGG 1 cut(s) 44
PinAI ACCGGT 2 cut(s) 423, 521
PleI GAGTC 2 cut(s) 7, 522
PpsI GAGTC 2 cut(s) 7, 522
PshBI ATTAAT 1 cut(s) 339
Psp6I CCWGG 2 cut(s) 18, 597
PspGI CCWGG 2 cut(s) 18, 597
PspN4I GGNNCC 2 cut(s) 231, 449
PspPI GGNCC 1 cut(s) 230
RsaI GTAC 1 cut(s) 269
RsaNI GTAC 1 cut(s) 268
SaqAI TTAA 3 cut(s) 156, 339, 614
Sau3AI GATC 1 cut(s) 210
Sau96I GGNCC 1 cut(s) 230
SchI GAGTC 2 cut(s) 7, 523
ScrFI CCNGG 2 cut(s) 20, 599
SetI ASST 9 cut(s) 24, 125, 253, 294, 351, 555, 620, 633, 650
SexAI ACCWGGT 1 cut(s) 18
SfaNI GCATC 1 cut(s) 235
SfcI CTRYAG 1 cut(s) 30
SinI GGWCC 1 cut(s) 230
SmlI CTYRAG 1 cut(s) 430
SmoI CTYRAG 1 cut(s) 430
Sse9I AATT 3 cut(s) 204, 223, 398
SsiI CCGC 1 cut(s) 573
SspMI CTAG 1 cut(s) 419
StyD4I CCNGG 2 cut(s) 18, 597
StyI CCWWGG 1 cut(s) 271
TaaI ACNGT 2 cut(s) 407, 504
TaqI TCGA 2 cut(s) 111, 517
TasI AATT 3 cut(s) 204, 223, 398
TfiI GAWTC 5 cut(s) 68, 108, 298, 454, 594
Tru1I TTAA 3 cut(s) 156, 339, 614
Tru9I TTAA 3 cut(s) 156, 339, 614
TscAI CASTG 3 cut(s) 400, 412, 477
TseFI GTSAC 2 cut(s) 277, 411
Tsp45I GTSAC 2 cut(s) 277, 411
TspDTI ATGAA 1 cut(s) 127
TspGWI ACGGA 2 cut(s) 151, 451
TspRI CASTG 3 cut(s) 400, 412, 477
Van91I CCANNNNNTGG 1 cut(s) 44
VpaK11BI GGWCC 1 cut(s) 230
VspI ATTAAT 1 cut(s) 339
XbaI TCTAGA 1 cut(s) 418
XmiI GTMKAC 1 cut(s) 499
XmnI GAANNNNTTC 1 cut(s) 322
XspI CTAG 1 cut(s) 419
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.