Rmu_sc0000263.1_g000001

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000263.1
N/A
Physical Location & Seq
Reverse (-)
3097 .. 3597
501 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 456 bp
ctgcaacgacatcacaattcgggcattgaaggatttgaaaccccagaacagaccccaaattatgtttctttgcgaaaccaaatcagcaatatcagggcctttaacgatcttcttttgtcacttggttttgctcatgctgaggaagtgctgagtgtaggacagtctggtggtttgggcatgttctggaatgataatgtgaaggtggaggtgggtacaacatcacagcatcatattgatatgaaggttgatggaggtcctggaaaccctagagacaaatcatggcagcttttgcgtgatttgagtgatttggatgcccttccttgggtagttatcggggattttaacaaaatgcttaatagcagtgagaagaaggatggtccaattagggctgagcagcagattcgtggttttagggaagccctaaggtatggggatttgcttgatcttgggttttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

151

Amino Acids

16.9

Weight (kDa)

5.28

Isoelectric Point (pI)

39.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 214
AfiI CCNNNNNNNGG 2 cut(s) 321, 322
AgsI TTSAA 2 cut(s) 29, 38
AjnI CCWGG 1 cut(s) 256
AjuI GAANNNNNNNTTGG 2 cut(s) 49, 81
AluBI AGCT 1 cut(s) 286
AluI AGCT 1 cut(s) 286
Alw26I GTCTC 1 cut(s) 264
AoxI GGCC 1 cut(s) 96
ApeKI GCWGC 2 cut(s) 283, 394
AspS9I GGNCC 3 cut(s) 96, 254, 377
AvaII GGWCC 2 cut(s) 254, 377
AxyI CCTNAGG 1 cut(s) 422
BbvCI CCTCAGC 1 cut(s) 138
BbvI GCAGC 2 cut(s) 295, 406
BccI CCATC 2 cut(s) 242, 368
BcgI CGANNNNNNTGC 2 cut(s) 383, 417
BciT130I CCWGG 1 cut(s) 258
BcoDI GTCTC 1 cut(s) 264
BfaI CTAG 1 cut(s) 267
BisI GCNGC 2 cut(s) 284, 395
BlpI GCTNAGC 1 cut(s) 390
BlsI GCNGC 2 cut(s) 285, 396
Bme1390I CCNGG 1 cut(s) 258
Bme18I GGWCC 2 cut(s) 254, 377
BmgT120I GGNCC 3 cut(s) 96, 254, 377
BmrFI CCNGG 1 cut(s) 258
BmsI GCATC 2 cut(s) 235, 301
Bpu10I CCTNAGC 1 cut(s) 138
Bpu1102I GCTNAGC 1 cut(s) 390
BsaJI CCNNGG 1 cut(s) 320
Bsc4I CCNNNNNNNGG 2 cut(s) 321, 322
Bse21I CCTNAGG 1 cut(s) 422
BseBI CCWGG 1 cut(s) 258
BseDI CCNNGG 1 cut(s) 320
BseGI GGATG 2 cut(s) 316, 379
BseLI CCNNNNNNNGG 2 cut(s) 321, 322
BseMII CTCAG 3 cut(s) 129, 140, 381
BseXI GCAGC 2 cut(s) 295, 406
BshFI GGCC 1 cut(s) 98
BslI CCNNNNNNNGG 2 cut(s) 321, 322
BsmAI GTCTC 1 cut(s) 264
BsnI GGCC 1 cut(s) 98
Bsp143I GATC 2 cut(s) 106, 442
Bsp1720I GCTNAGC 1 cut(s) 390
BspANI GGCC 1 cut(s) 98
BspCNI CTCAG 3 cut(s) 130, 141, 382
BssECI CCNNGG 1 cut(s) 320
BssMI GATC 2 cut(s) 106, 442
BssT1I CCWWGG 1 cut(s) 320
Bst2UI CCWGG 1 cut(s) 258
Bst4CI ACNGT 1 cut(s) 162
BstAPI GCANNNNNTGC 1 cut(s) 289
BstDEI CTNAG 4 cut(s) 138, 149, 390, 422
BstF5I GGATG 2 cut(s) 316, 379
BstKTI GATC 2 cut(s) 109, 445
BstMAI GTCTC 1 cut(s) 264
BstMBI GATC 2 cut(s) 106, 442
BstMWI GCNNNNNNNGC 1 cut(s) 289
BstNI CCWGG 1 cut(s) 258
BstNSI RCATGY 1 cut(s) 181
BstSCI CCNGG 1 cut(s) 256
BstV1I GCAGC 2 cut(s) 295, 406
Bsu36I CCTNAGG 1 cut(s) 422
BsuRI GGCC 1 cut(s) 98
BtsCI GGATG 2 cut(s) 316, 379
BtsI GCAGTG 1 cut(s) 367
BtsIMutI CAGTG 1 cut(s) 367
Cfr13I GGNCC 3 cut(s) 96, 254, 377
Csp6I GTAC 1 cut(s) 213
CviAII CATG 3 cut(s) 134, 178, 279
CviJI RGCY 4 cut(s) 98, 286, 389, 419
CviKI_1 RGCY 4 cut(s) 98, 286, 389, 419
CviQI GTAC 1 cut(s) 213
DdeI CTNAG 4 cut(s) 138, 149, 390, 422
DpnI GATC 2 cut(s) 108, 444
DpnII GATC 2 cut(s) 106, 442
Eco130I CCWWGG 1 cut(s) 320
Eco47I GGWCC 2 cut(s) 254, 377
Eco81I CCTNAGG 1 cut(s) 422
EcoO109I RGGNCCY 2 cut(s) 96, 254
EcoRII CCWGG 1 cut(s) 256
EcoT14I CCWWGG 1 cut(s) 320
ErhI CCWWGG 1 cut(s) 320
FaeI CATG 3 cut(s) 137, 181, 282
FaiI YATR 7 cut(s) 63, 135, 179, 231, 239, 280, 429
FatI CATG 3 cut(s) 133, 177, 278
Fnu4HI GCNGC 2 cut(s) 284, 395
FokI GGATG 2 cut(s) 323, 386
Fsp4HI GCNGC 2 cut(s) 284, 395
FspBI CTAG 1 cut(s) 267
GluI GCNGC 2 cut(s) 284, 395
HaeIII GGCC 1 cut(s) 98
Hin1II CATG 3 cut(s) 137, 181, 282
HinfI GANTC 1 cut(s) 400
Hpy188III TCNNGA 1 cut(s) 184
HpyAV CCTTC 5 cut(s) 23, 193, 235, 326, 364
HpyCH4III ACNGT 1 cut(s) 162
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 289
HpyF3I CTNAG 4 cut(s) 138, 149, 390, 422
Hsp92II CATG 3 cut(s) 137, 181, 282
Kzo9I GATC 2 cut(s) 106, 442
LpnPI CCDG 6 cut(s) 57, 79, 150, 169, 243, 270
Lsp1109I GCAGC 2 cut(s) 295, 406
LweI GCATC 2 cut(s) 235, 301
MaeI CTAG 1 cut(s) 267
MaeIII GTNAC 1 cut(s) 117
MalI GATC 2 cut(s) 108, 444
MboI GATC 2 cut(s) 106, 442
MboII GAAGA 2 cut(s) 101, 379
MluCI AATT 3 cut(s) 16, 58, 381
MnlI CCTC 3 cut(s) 133, 199, 245
MseI TTAA 3 cut(s) 102, 342, 354
MspR9I CCNGG 1 cut(s) 258
MvaI CCWGG 1 cut(s) 258
MwoI GCNNNNNNNGC 1 cut(s) 289
NdeII GATC 2 cut(s) 106, 442
NlaIII CATG 3 cut(s) 137, 181, 282
NmuCI GTSAC 1 cut(s) 117
NspI RCATGY 1 cut(s) 181
PfeI GAWTC 1 cut(s) 400
PfoI TCCNGGA 1 cut(s) 256
PkrI GCNGC 2 cut(s) 285, 396
PpuMI RGGWCCY 1 cut(s) 254
Psp5II RGGWCCY 1 cut(s) 254
Psp6I CCWGG 1 cut(s) 256
PspGI CCWGG 1 cut(s) 256
PspPI GGNCC 3 cut(s) 96, 254, 377
PspPPI RGGWCCY 1 cut(s) 254
RsaI GTAC 1 cut(s) 214
RsaNI GTAC 1 cut(s) 213
SaqAI TTAA 3 cut(s) 102, 342, 354
SatI GCNGC 2 cut(s) 284, 395
Sau3AI GATC 2 cut(s) 106, 442
Sau96I GGNCC 3 cut(s) 96, 254, 377
ScrFI CCNGG 1 cut(s) 258
SetI ASST 6 cut(s) 204, 210, 246, 256, 288, 428
SfaNI GCATC 2 cut(s) 235, 301
SinI GGWCC 2 cut(s) 254, 377
Sse9I AATT 3 cut(s) 16, 58, 381
SspMI CTAG 1 cut(s) 267
StyD4I CCNGG 1 cut(s) 256
StyI CCWWGG 1 cut(s) 320
TaaI ACNGT 1 cut(s) 162
TasI AATT 3 cut(s) 16, 58, 381
TfiI GAWTC 1 cut(s) 400
Tru1I TTAA 3 cut(s) 102, 342, 354
Tru9I TTAA 3 cut(s) 102, 342, 354
TscAI CASTG 1 cut(s) 367
TseFI GTSAC 1 cut(s) 117
TseI GCWGC 2 cut(s) 283, 394
Tsp45I GTSAC 1 cut(s) 117
TspDTI ATGAA 1 cut(s) 254
TspRI CASTG 1 cut(s) 367
VpaK11BI GGWCC 2 cut(s) 254, 377
XceI RCATGY 1 cut(s) 181
XspI CTAG 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.