Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000385.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

117005 .. 117916

Gene Structure 912 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000385.1_g000023.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 513 bp

atgggttcctccggtttgatcagagagaactgggggttgatccagcaagccaagtcgttgttcgggtcagatcagccggacccggaaacaggaccgctcgagttcatcaatcggaacttctccatttttgacatcagcatcattgccggcgtgcaagaagaggatcacagctcgtacaatgacgacaagaaacatgtttttggttctagcaagaagaagaacagagcttcgaacccaaaccaggacttcgcagattccgactgccaaatgaaaaaagcgccgaagaaatggggccggaaacccaggctgggccgagacacgccgctcaaccacttggaggcggagcgggtgtggacgtcacagagcgagatggtgaggaatggaactgttgaagccgaggttcgtgaggcgtctcgagcaggaaatggagatcgaagttacgaggctatgcaagatattgaggcgctgatttcaatcatggtgatctttaagctcagacgtgactggagataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0006355 GO:0008150 GO:0009889 GO:0009892 GO:0010468 GO:0010556 GO:0010605 GO:0010629 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0048519 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

ko04016 ko04075 map04016 map04075

Pfam Domains

Protein Families

HLH bHLH-MYC_N

Protein Analysis

170

Amino Acids

19.34

Weight (kDa)

6.85

Isoelectric Point (pI)

28.88

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	359
AccBSI	CCGCTC	3 cut(s)	97, 325, 346
AciI	CCGC	4 cut(s)	95, 323, 341, 346
AclWI	GGATC	2 cut(s)	34, 171
AcyI	GRCGYC	2 cut(s)	356, 410
AfaI	GTAC	1 cut(s)	176
AfiI	CCNNNNNNNGG	4 cut(s)	89, 241, 308, 337
AflIII	ACRYGT	1 cut(s)	193
AgsI	TTSAA	2 cut(s)	392, 474
AjiI	CACGTC	1 cut(s)	500
AjnI	CCWGG	2 cut(s)	240, 302
AjuI	GAANNNNNNNTTGG	2 cut(s)	44, 76
AluBI	AGCT	3 cut(s)	171, 227, 493
AluI	AGCT	3 cut(s)	171, 227, 493
Alw26I	GTCTC	2 cut(s)	309, 417
AlwI	GGATC	2 cut(s)	34, 171
Ama87I	CYCGRG	2 cut(s)	98, 414
AoxI	GGCC	2 cut(s)	292, 310
AspLEI	GCGC	2 cut(s)	280, 466
AspS9I	GGNCC	4 cut(s)	79, 92, 292, 310
AsuC2I	CCSGG	1 cut(s)	83
AsuHPI	GGTGA	2 cut(s)	385, 493
AsuII	TTCGAA	1 cut(s)	230
AvaI	CYCGRG	2 cut(s)	98, 414
AvaII	GGWCC	2 cut(s)	79, 92
BccI	CCATC	1 cut(s)	364
BciT130I	CCWGG	2 cut(s)	242, 304
BclI	TGATCA	1 cut(s)	18
BcnI	CCSGG	1 cut(s)	83
BcoDI	GTCTC	2 cut(s)	309, 417
BfaI	CTAG	1 cut(s)	207
BfoI	RGCGCY	2 cut(s)	281, 467
BisI	GCNGC	1 cut(s)	323
BlsI	GCNGC	1 cut(s)	324
Bme1390I	CCNGG	3 cut(s)	83, 242, 304
Bme18I	GGWCC	2 cut(s)	79, 92
BmeT110I	CYCGRG	2 cut(s)	98, 414
BmgBI	CACGTC	1 cut(s)	500
BmgT120I	GGNCC	4 cut(s)	79, 92, 292, 310
BmiI	GGNNCC	3 cut(s)	7, 81, 293
BmrFI	CCNGG	3 cut(s)	83, 242, 304
BmrI	ACTGGG	1 cut(s)	40
BmsI	GCATC	1 cut(s)	147
BmuI	ACTGGG	1 cut(s)	40
Bpu14I	TTCGAA	1 cut(s)	230
BpuMI	CCSGG	1 cut(s)	83
BsaBI	GATNNNNATC	1 cut(s)	473
BsaHI	GRCGYC	2 cut(s)	356, 410
BsaJI	CCNNGG	2 cut(s)	302, 396
BsaWI	WCCGGW	1 cut(s)	11
BsaXI	ACNNNNNCTCC	2 cut(s)	335, 365
Bsc4I	CCNNNNNNNGG	4 cut(s)	89, 241, 308, 337
Bse118I	RCCGGY	1 cut(s)	146
Bse1I	ACTGG	2 cut(s)	35, 509
Bse3DI	GCAATG	1 cut(s)	141
Bse8I	GATNNNNATC	1 cut(s)	473
BseBI	CCWGG	2 cut(s)	242, 304
BseDI	CCNNGG	2 cut(s)	302, 396
BseJI	GATNNNNATC	1 cut(s)	473
BseLI	CCNNNNNNNGG	4 cut(s)	89, 241, 308, 337
BseMI	GCAATG	1 cut(s)	141
BseMII	CTCAG	1 cut(s)	508
BseNI	ACTGG	2 cut(s)	35, 509
BseYI	CCCAGC	1 cut(s)	307
BshFI	GGCC	2 cut(s)	294, 312
BsiHKCI	CYCGRG	2 cut(s)	98, 414
BsiSI	CCGG	5 cut(s)	12, 77, 83, 147, 295
BslI	CCNNNNNNNGG	4 cut(s)	89, 241, 308, 337
BsmAI	GTCTC	2 cut(s)	309, 417
BsmBI	CGTCTC	1 cut(s)	417
BsnI	GGCC	2 cut(s)	294, 312
BsoBI	CYCGRG	2 cut(s)	98, 414
Bsp119I	TTCGAA	1 cut(s)	230
Bsp143I	GATC	6 cut(s)	18, 39, 70, 163, 430, 483
BspACI	CCGC	4 cut(s)	95, 323, 341, 346
BspANI	GGCC	2 cut(s)	294, 312
BspCNI	CTCAG	1 cut(s)	507
BspLI	GGNNCC	3 cut(s)	7, 81, 293
BspPI	GGATC	2 cut(s)	34, 171
BspT104I	TTCGAA	1 cut(s)	230
BsrBI	CCGCTC	3 cut(s)	97, 325, 346
BsrDI	GCAATG	1 cut(s)	141
BsrFI	RCCGGY	1 cut(s)	146
BsrI	ACTGG	2 cut(s)	35, 509
BssAI	RCCGGY	1 cut(s)	146
BssECI	CCNNGG	2 cut(s)	302, 396
BssMI	GATC	6 cut(s)	18, 39, 70, 163, 430, 483
BssNI	GRCGYC	2 cut(s)	356, 410
Bst2UI	CCWGG	2 cut(s)	242, 304
Bst4CI	ACNGT	1 cut(s)	388
Bst6I	CTCTTC	1 cut(s)	153
BstACI	GRCGYC	2 cut(s)	356, 410
BstBI	TTCGAA	1 cut(s)	230
BstC8I	GCNNGC	3 cut(s)	48, 148, 152
BstDEI	CTNAG	1 cut(s)	494
BstH2I	RGCGCY	2 cut(s)	281, 467
BstHHI	GCGC	2 cut(s)	280, 466
BstKTI	GATC	6 cut(s)	21, 42, 73, 166, 433, 486
BstMAI	GTCTC	2 cut(s)	309, 417
BstMBI	GATC	6 cut(s)	18, 39, 70, 163, 430, 483
BstMWI	GCNNNNNNNGC	1 cut(s)	416
BstNI	CCWGG	2 cut(s)	242, 304
BstNSI	RCATGY	1 cut(s)	197
BstSCI	CCNGG	3 cut(s)	81, 240, 302
BsuRI	GGCC	2 cut(s)	294, 312
BtrI	CACGTC	1 cut(s)	500
Cac8I	GCNNGC	3 cut(s)	48, 148, 152
CfoI	GCGC	2 cut(s)	280, 466
Cfr10I	RCCGGY	1 cut(s)	146
Cfr13I	GGNCC	4 cut(s)	79, 92, 292, 310
CseI	GACGC	1 cut(s)	399
Csp6I	GTAC	1 cut(s)	175
CviAII	CATG	2 cut(s)	194, 478
CviQI	GTAC	1 cut(s)	175
DdeI	CTNAG	1 cut(s)	494
DpnI	GATC	6 cut(s)	20, 41, 72, 165, 432, 485
DpnII	GATC	6 cut(s)	18, 39, 70, 163, 430, 483
Eam1104I	CTCTTC	1 cut(s)	153
EarI	CTCTTC	1 cut(s)	153
EciI	GGCGGA	1 cut(s)	356
Eco47I	GGWCC	2 cut(s)	79, 92
Eco88I	CYCGRG	2 cut(s)	98, 414
EcoRII	CCWGG	2 cut(s)	240, 302
Esp3I	CGTCTC	1 cut(s)	417
FaeI	CATG	2 cut(s)	197, 481
FaiI	YATR	3 cut(s)	195, 449, 479
FatI	CATG	2 cut(s)	193, 477
FauI	CCCGC	1 cut(s)	339
FbaI	TGATCA	1 cut(s)	18
Fnu4HI	GCNGC	1 cut(s)	323
Fsp4HI	GCNGC	1 cut(s)	323
FspBI	CTAG	1 cut(s)	207
GlaI	GCGC	2 cut(s)	279, 465
GluI	GCNGC	1 cut(s)	323
GsaI	CCCAGC	1 cut(s)	311
HaeII	RGCGCY	2 cut(s)	281, 467
HaeIII	GGCC	2 cut(s)	294, 312
HapII	CCGG	5 cut(s)	12, 77, 83, 147, 295
HgaI	GACGC	1 cut(s)	399
HhaI	GCGC	2 cut(s)	280, 466
Hin1I	GRCGYC	2 cut(s)	356, 410
Hin1II	CATG	2 cut(s)	197, 481
Hin6I	GCGC	2 cut(s)	278, 464
HinP1I	GCGC	2 cut(s)	278, 464
HinfI	GANTC	1 cut(s)	254
HpaII	CCGG	5 cut(s)	12, 77, 83, 147, 295
HphI	GGTGA	2 cut(s)	385, 493
Hpy166II	GTNNAC	1 cut(s)	354
Hpy188I	TCNGA	5 cut(s)	23, 70, 114, 259, 497
Hpy188III	TCNNGA	2 cut(s)	404, 414
Hpy8I	GTNNAC	1 cut(s)	354
HpyCH4III	ACNGT	1 cut(s)	388
HpyCH4IV	ACGT	2 cut(s)	356, 499
HpyCH4V	TGCA	2 cut(s)	154, 451
HpyF10VI	GCNNNNNNNGC	1 cut(s)	416
HpyF3I	CTNAG	1 cut(s)	494
HpySE526I	ACGT	2 cut(s)	356, 499
Hsp92I	GRCGYC	2 cut(s)	356, 410
Hsp92II	CATG	2 cut(s)	197, 481
HspAI	GCGC	2 cut(s)	278, 464
KroI	GCCGGC	1 cut(s)	146
KroNI	GCCGGC	1 cut(s)	148
Ksp22I	TGATCA	1 cut(s)	18
Kzo9I	GATC	6 cut(s)	18, 39, 70, 163, 430, 483
LmnI	GCTCC	1 cut(s)	343
LweI	GCATC	1 cut(s)	147
MaeI	CTAG	1 cut(s)	207
MaeII	ACGT	2 cut(s)	356, 499
MaeIII	GTNAC	3 cut(s)	357, 437, 500
MalI	GATC	6 cut(s)	20, 41, 72, 165, 432, 485
MbiI	CCGCTC	3 cut(s)	97, 325, 346
MboI	GATC	6 cut(s)	18, 39, 70, 163, 430, 483
MboII	GAAGA	4 cut(s)	170, 226, 229, 295
MmeI	TCCRAC	1 cut(s)	282
MnlI	CCTC	8 cut(s)	19, 154, 331, 369, 391, 400, 436, 454
MroNI	GCCGGC	1 cut(s)	146
MseI	TTAA	1 cut(s)	489
MspI	CCGG	5 cut(s)	12, 77, 83, 147, 295
MspR9I	CCNGG	3 cut(s)	83, 242, 304
MvaI	CCWGG	2 cut(s)	242, 304
MwoI	GCNNNNNNNGC	1 cut(s)	416
NaeI	GCCGGC	1 cut(s)	148
NciI	CCSGG	1 cut(s)	83
NdeII	GATC	6 cut(s)	18, 39, 70, 163, 430, 483
NgoMIV	GCCGGC	1 cut(s)	146
NlaIII	CATG	2 cut(s)	197, 481
NlaIV	GGNNCC	3 cut(s)	7, 81, 293
NmeAIII	GCCGAG	2 cut(s)	338, 421
NmuCI	GTSAC	2 cut(s)	357, 500
NspI	RCATGY	1 cut(s)	197
NspV	TTCGAA	1 cut(s)	230
PaeR7I	CTCGAG	2 cut(s)	98, 414
PciI	ACATGT	1 cut(s)	193
PcsI	WCGNNNNNNNCGW	1 cut(s)	255
PdiI	GCCGGC	1 cut(s)	148
PfeI	GAWTC	1 cut(s)	254
PkrI	GCNGC	1 cut(s)	324
PscI	ACATGT	1 cut(s)	193
Psp6I	CCWGG	2 cut(s)	240, 302
PspFI	CCCAGC	1 cut(s)	307
PspGI	CCWGG	2 cut(s)	240, 302
PspN4I	GGNNCC	3 cut(s)	7, 81, 293
PspPI	GGNCC	4 cut(s)	79, 92, 292, 310
PspXI	VCTCGAGB	1 cut(s)	98
RsaI	GTAC	1 cut(s)	176
RsaNI	GTAC	1 cut(s)	175
SaqAI	TTAA	1 cut(s)	489
SatI	GCNGC	1 cut(s)	323
Sau3AI	GATC	6 cut(s)	18, 39, 70, 163, 430, 483
Sau96I	GGNCC	4 cut(s)	79, 92, 292, 310
ScrFI	CCNGG	3 cut(s)	83, 242, 304
SetI	ASST	6 cut(s)	173, 229, 359, 402, 495, 502
SfaNI	GCATC	1 cut(s)	147
Sfr274I	CTCGAG	2 cut(s)	98, 414
SfuI	TTCGAA	1 cut(s)	230
SinI	GGWCC	2 cut(s)	79, 92
SlaI	CTCGAG	2 cut(s)	98, 414
SmlI	CTYRAG	2 cut(s)	98, 414
SmoI	CTYRAG	2 cut(s)	98, 414
SsiI	CCGC	4 cut(s)	95, 323, 341, 346
SspMI	CTAG	1 cut(s)	207
StyD4I	CCNGG	3 cut(s)	81, 240, 302
TaaI	ACNGT	1 cut(s)	388
TaiI	ACGT	2 cut(s)	359, 502
TaqI	TCGA	4 cut(s)	99, 230, 415, 433
TauI	GCSGC	1 cut(s)	325
TfiI	GAWTC	1 cut(s)	254
Tru1I	TTAA	1 cut(s)	489
Tru9I	TTAA	1 cut(s)	489
TseFI	GTSAC	2 cut(s)	357, 500
Tsp45I	GTSAC	2 cut(s)	357, 500
TspDTI	ATGAA	2 cut(s)	94, 284
VpaK11BI	GGWCC	2 cut(s)	79, 92
XceI	RCATGY	1 cut(s)	197
XhoI	CTCGAG	2 cut(s)	98, 414
XspI	CTAG	1 cut(s)	207
ZraI	GACGTC	1 cut(s)	357

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.