Rmu_sc0000435.1_g000037

This protein is an auxiliary protein of DNA polymerase delta and is involved in the control of eukaryotic DNA replication by increasing the polymerase's processibility during elongation of the leading strand

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000435.1
N/A
Physical Location & Seq
Forward (+)
168347 .. 169171
825 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 384 bp
atgaagctgatggacattgatagtgagcaccttggaattccggaggcagaataccatgcaattgttaggatgccttctgctgaatttgccaggatttgcaaagacctcagcggcattggtgatactggtattgttcttatccctctagaagtgcctgaagaagcaacaatcatagagatgaatgagccagtttcattgacatttgctctgaggtacatgaactccttcacaaaagcatcccccctgtcaaacacagtcactatcagcctctcttcggaactaccagttgtggttgagtacaagattgctgagatgggctacataaggttctacttggctccgaaggtagaagaggatgaagatgagacaaagcctcaagtttga

Protein Analysis

127

Amino Acids

14.18

Weight (kDa)

4.43

Isoelectric Point (pI)

46.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PCNA_C PF02747 12 - 47 4.5e-10 Proliferating cell nuclear antigen, C-terminal domain
PCNA_C PF02747 50 - 115 7.6e-27 Proliferating cell nuclear antigen, C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 40
AciI CCGC 1 cut(s) 111
AcsI RAATTY 2 cut(s) 36, 83
AcuI CTGAAG 1 cut(s) 177
AfaI GTAC 2 cut(s) 215, 299
AfiI CCNNNNNNNGG 1 cut(s) 274
AjnI CCWGG 1 cut(s) 89
AluBI AGCT 1 cut(s) 7
AluI AGCT 1 cut(s) 7
Alw21I GWGCWC 1 cut(s) 30
Alw26I GTCTC 1 cut(s) 359
Aor13HI TCCGGA 1 cut(s) 40
ApoI RAATTY 2 cut(s) 36, 83
Asp700I GAANNNNTTC 1 cut(s) 224
AsuHPI GGTGA 1 cut(s) 131
Bbv12I GWGCWC 1 cut(s) 30
BbvCI CCTCAGC 1 cut(s) 107
BccI CCATC 2 cut(s) 4, 307
BciT130I CCWGG 1 cut(s) 91
BcoDI GTCTC 1 cut(s) 359
BfaI CTAG 1 cut(s) 146
BisI GCNGC 1 cut(s) 112
BlsI GCNGC 1 cut(s) 113
Bme1390I CCNGG 1 cut(s) 91
BmiI GGNNCC 1 cut(s) 339
BmrFI CCNGG 1 cut(s) 91
BmsI GCATC 2 cut(s) 60, 245
Bpu10I CCTNAGC 1 cut(s) 107
BpuEI CTTGAG 1 cut(s) 360
BsaJI CCNNGG 1 cut(s) 31
BsaWI WCCGGW 1 cut(s) 40
BsaXI ACNNNNNCTCC 2 cut(s) 206, 236
Bsc4I CCNNNNNNNGG 1 cut(s) 274
Bse1I ACTGG 3 cut(s) 130, 188, 284
BseAI TCCGGA 1 cut(s) 40
BseBI CCWGG 1 cut(s) 91
BseDI CCNNGG 1 cut(s) 31
BseGI GGATG 3 cut(s) 75, 236, 361
BseLI CCNNNNNNNGG 1 cut(s) 274
BseMII CTCAG 3 cut(s) 121, 200, 300
BseNI ACTGG 3 cut(s) 130, 188, 284
BsiHKAI GWGCWC 1 cut(s) 30
BsiSI CCGG 1 cut(s) 41
BslI CCNNNNNNNGG 1 cut(s) 274
BsmAI GTCTC 1 cut(s) 359
Bsp1286I GDGCHC 1 cut(s) 30
Bsp13I TCCGGA 1 cut(s) 40
BspACI CCGC 1 cut(s) 111
BspCNI CTCAG 3 cut(s) 120, 201, 301
BspEI TCCGGA 1 cut(s) 40
BspLI GGNNCC 1 cut(s) 339
BsrI ACTGG 3 cut(s) 130, 188, 284
BssECI CCNNGG 1 cut(s) 31
BssT1I CCWWGG 1 cut(s) 31
Bst2UI CCWGG 1 cut(s) 91
Bst4CI ACNGT 1 cut(s) 256
Bst6I CTCTTC 2 cut(s) 277, 345
BstDEI CTNAG 3 cut(s) 107, 209, 309
BstF5I GGATG 3 cut(s) 75, 236, 361
BstMAI GTCTC 1 cut(s) 359
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstNI CCWGG 1 cut(s) 91
BstSCI CCNGG 1 cut(s) 89
BtsCI GGATG 3 cut(s) 75, 236, 361
Csp6I GTAC 2 cut(s) 214, 298
CviAII CATG 2 cut(s) 56, 217
CviJI RGCY 6 cut(s) 7, 187, 267, 318, 338, 373
CviKI_1 RGCY 6 cut(s) 7, 187, 267, 318, 338, 373
CviQI GTAC 2 cut(s) 214, 298
DdeI CTNAG 3 cut(s) 107, 209, 309
Eam1104I CTCTTC 2 cut(s) 277, 345
EarI CTCTTC 2 cut(s) 277, 345
Eco130I CCWWGG 1 cut(s) 31
Eco57I CTGAAG 1 cut(s) 177
EcoRI GAATTC 1 cut(s) 36
EcoRII CCWGG 1 cut(s) 89
EcoT14I CCWWGG 1 cut(s) 31
ErhI CCWWGG 1 cut(s) 31
FaeI CATG 2 cut(s) 59, 220
FaiI YATR 4 cut(s) 57, 173, 218, 323
FatI CATG 2 cut(s) 55, 216
Fnu4HI GCNGC 1 cut(s) 112
FokI GGATG 3 cut(s) 82, 223, 368
Fsp4HI GCNGC 1 cut(s) 112
FspBI CTAG 1 cut(s) 146
GluI GCNGC 1 cut(s) 112
HapII CCGG 1 cut(s) 41
Hin1II CATG 2 cut(s) 59, 220
HpaII CCGG 1 cut(s) 41
HphI GGTGA 1 cut(s) 131
Hpy188I TCNGA 3 cut(s) 210, 277, 342
Hpy188III TCNNGA 2 cut(s) 41, 146
HpyAV CCTTC 3 cut(s) 84, 235, 337
HpyCH4III ACNGT 1 cut(s) 256
HpyCH4V TGCA 2 cut(s) 59, 99
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 3 cut(s) 107, 209, 309
Hsp92II CATG 2 cut(s) 59, 220
Kpn2I TCCGGA 1 cut(s) 40
LmnI GCTCC 1 cut(s) 343
LpnPI CCDG 8 cut(s) 54, 76, 103, 111, 168, 201, 257, 297
LweI GCATC 2 cut(s) 60, 245
MaeI CTAG 1 cut(s) 146
MaeIII GTNAC 1 cut(s) 256
MboII GAAGA 4 cut(s) 170, 264, 362, 371
MfeI CAATTG 1 cut(s) 60
MhlI GDGCHC 1 cut(s) 30
MluCI AATT 3 cut(s) 36, 60, 83
MnlI CCTC 7 cut(s) 37, 116, 153, 204, 278, 346, 384
MroI TCCGGA 1 cut(s) 40
MroXI GAANNNNTTC 1 cut(s) 224
MslI CAYNNNNRTG 1 cut(s) 176
MspA1I CMGCKG 1 cut(s) 111
MspI CCGG 1 cut(s) 41
MspR9I CCNGG 1 cut(s) 91
MunI CAATTG 1 cut(s) 60
MvaI CCWGG 1 cut(s) 91
MwoI GCNNNNNNNGC 1 cut(s) 86
NlaIII CATG 2 cut(s) 59, 220
NlaIV GGNNCC 1 cut(s) 339
NmuCI GTSAC 1 cut(s) 256
PdmI GAANNNNTTC 1 cut(s) 224
PkrI GCNGC 1 cut(s) 113
Psp6I CCWGG 1 cut(s) 89
PspGI CCWGG 1 cut(s) 89
PspN4I GGNNCC 1 cut(s) 339
RsaI GTAC 2 cut(s) 215, 299
RsaNI GTAC 2 cut(s) 214, 298
RseI CAYNNNNRTG 1 cut(s) 176
SatI GCNGC 1 cut(s) 112
ScrFI CCNGG 1 cut(s) 91
SduI GDGCHC 1 cut(s) 30
SetI ASST 6 cut(s) 9, 33, 108, 215, 329, 348
SfaNI GCATC 2 cut(s) 60, 245
SmiMI CAYNNNNRTG 1 cut(s) 176
SmlI CTYRAG 1 cut(s) 375
SmoI CTYRAG 1 cut(s) 375
Sse9I AATT 3 cut(s) 36, 60, 83
SsiI CCGC 1 cut(s) 111
SspMI CTAG 1 cut(s) 146
StyD4I CCNGG 1 cut(s) 89
StyI CCWWGG 1 cut(s) 31
TaaI ACNGT 1 cut(s) 256
TasI AATT 3 cut(s) 36, 60, 83
TatI WGTACW 1 cut(s) 297
TauI GCSGC 1 cut(s) 114
TseFI GTSAC 1 cut(s) 256
Tsp45I GTSAC 1 cut(s) 256
TspDTI ATGAA 5 cut(s) 17, 183, 194, 233, 372
XapI RAATTY 2 cut(s) 36, 83
XbaI TCTAGA 1 cut(s) 145
XmnI GAANNNNTTC 1 cut(s) 224
XspI CTAG 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.