Rmu_sc0000600.1_g000055

Vacuolar protein sorting-associated protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000600.1
N/A
Physical Location & Seq
Forward (+)
279622 .. 280872
1251 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 258 bp
atggacactcaaaaggaggaggaggtcgtttggttgaaaagactcatacaagcaacatatcaagcttctgctccctcttcagttgatgtcttgggagaaacaattgatcgtgttgctgagattggtgagcctcctcagaccggcaattctaaaacagctgaccttgtcattaatggggcattggtggagacaaagttatctatttatggaaagacgggtgataaaggtgctgaagaacttgatgagactgatgcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
C2 Chorein_N Pex24p SHR-BD VPS13 VPS13_C VPS13_mid_rpt Vps62

Protein Analysis

85

Amino Acids

9.14

Weight (kDa)

4.25

Isoelectric Point (pI)

21.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 2 cut(s) 63, 252
AfiI CCNNNNNNNGG 1 cut(s) 140
AgsI TTSAA 1 cut(s) 37
AluBI AGCT 2 cut(s) 65, 158
AluI AGCT 2 cut(s) 65, 158
Alw26I GTCTC 2 cut(s) 182, 239
AseI ATTAAT 1 cut(s) 171
AsuHPI GGTGA 2 cut(s) 137, 230
BcoDI GTCTC 2 cut(s) 182, 239
BmsI GCATC 1 cut(s) 241
BsaXI ACNNNNNCTCC 2 cut(s) 179, 209
Bsc4I CCNNNNNNNGG 1 cut(s) 140
Bse118I RCCGGY 1 cut(s) 140
BseLI CCNNNNNNNGG 1 cut(s) 140
BseMII CTCAG 2 cut(s) 108, 149
BseRI GAGGAG 3 cut(s) 32, 35, 123
BsiSI CCGG 1 cut(s) 141
BslI CCNNNNNNNGG 1 cut(s) 140
BsmAI GTCTC 2 cut(s) 182, 239
Bsp143I GATC 1 cut(s) 106
BspCNI CTCAG 2 cut(s) 109, 148
BsrFI RCCGGY 1 cut(s) 140
BssAI RCCGGY 1 cut(s) 140
BssMI GATC 1 cut(s) 106
Bst6I CTCTTC 1 cut(s) 82
BstDEI CTNAG 2 cut(s) 117, 135
BstKTI GATC 1 cut(s) 109
BstMAI GTCTC 2 cut(s) 182, 239
BstMBI GATC 1 cut(s) 106
Cfr10I RCCGGY 1 cut(s) 140
CviJI RGCY 3 cut(s) 65, 130, 158
CviKI_1 RGCY 3 cut(s) 65, 130, 158
DdeI CTNAG 2 cut(s) 117, 135
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
Eam1104I CTCTTC 1 cut(s) 82
EarI CTCTTC 1 cut(s) 82
Eco57I CTGAAG 2 cut(s) 63, 252
FaiI YATR 3 cut(s) 47, 58, 207
HapII CCGG 1 cut(s) 141
HindIII AAGCTT 1 cut(s) 63
HinfI GANTC 1 cut(s) 42
HpaII CCGG 1 cut(s) 141
HphI GGTGA 2 cut(s) 137, 230
Hpy188I TCNGA 1 cut(s) 138
HpyF3I CTNAG 2 cut(s) 117, 135
Kzo9I GATC 1 cut(s) 106
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 1 cut(s) 154
LweI GCATC 1 cut(s) 241
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MboII GAAGA 2 cut(s) 69, 245
MfeI CAATTG 1 cut(s) 102
MluCI AATT 2 cut(s) 102, 145
MlyI GAGTC 1 cut(s) 36
MnlI CCTC 6 cut(s) 10, 13, 16, 85, 141, 144
MseI TTAA 1 cut(s) 171
MspA1I CMGCKG 1 cut(s) 158
MspI CCGG 1 cut(s) 141
MunI CAATTG 1 cut(s) 102
NdeII GATC 1 cut(s) 106
PflFI GACNNNGTC 1 cut(s) 164
PleI GAGTC 1 cut(s) 36
PpsI GAGTC 1 cut(s) 36
PshBI ATTAAT 1 cut(s) 171
PsyI GACNNNGTC 1 cut(s) 164
PvuII CAGCTG 1 cut(s) 158
SaqAI TTAA 1 cut(s) 171
Sau3AI GATC 1 cut(s) 106
SchI GAGTC 1 cut(s) 36
SetI ASST 5 cut(s) 27, 67, 160, 165, 229
SfaNI GCATC 1 cut(s) 241
SgeI CNNG 8 cut(s) 62, 74, 103, 122, 153, 176, 228, 251
Sse9I AATT 2 cut(s) 102, 145
TasI AATT 2 cut(s) 102, 145
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
Tth111I GACNNNGTC 1 cut(s) 164
VspI ATTAAT 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.