Rmu_sc0000617.1_g000001

Helicase-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000617.1
N/A
Physical Location & Seq
Reverse (-)
610 .. 1095
486 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 486 bp
atggcacaagactactcaacatctgcctcttcaagtaatcatgttgtcatcaacctattattgagagacctgaatggattgctacaacagcatggtaaaagaattactgattatgatcttccccaaattgatactcagtttgcagatgacacaagaattggaagaaatatacaagatgagttgtccgtgcatgttccaccggaagacttggcctctattgatacattaaatgcagatcaacgtaatgcatttaacataatcatggcagcaattagacgtaatgaatcagcatcattcttcatagatggccccggtggaactggaaagacttatctctaccgtgcaattcttgcttcactaaggagtaacggtcatatagcaattgccacagctacatcgggaattgcagctactattttgcctggtggaaggactgcacattcacgatttaaaattccaattgacttgctgtccacaaacagttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Helitron_like_N PIF1

Protein Analysis

161

Amino Acids

17.45

Weight (kDa)

6.17

Isoelectric Point (pI)

42.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PIF1 PF05970 76 - 156 1.6e-28 PIF1-like helicase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 453
AgsI TTSAA 1 cut(s) 33
AhdI GACNNNNNGTC 1 cut(s) 469
AjnI CCWGG 1 cut(s) 421
AluBI AGCT 2 cut(s) 392, 410
AluI AGCT 2 cut(s) 392, 410
Alw26I GTCTC 1 cut(s) 60
AoxI GGCC 2 cut(s) 210, 307
ApeKI GCWGC 2 cut(s) 266, 407
ApoI RAATTY 1 cut(s) 453
AspS9I GGNCC 1 cut(s) 308
AsuC2I CCSGG 1 cut(s) 312
BbsI GAAGAC 1 cut(s) 210
BbvI GCAGC 2 cut(s) 278, 419
BccI CCATC 1 cut(s) 299
BciT130I CCWGG 1 cut(s) 423
BcnI CCSGG 1 cut(s) 312
BcoDI GTCTC 1 cut(s) 60
BisI GCNGC 2 cut(s) 267, 408
BlsI GCNGC 2 cut(s) 268, 409
Bme1390I CCNGG 2 cut(s) 312, 423
BmeRI GACNNNNNGTC 1 cut(s) 469
BmgT120I GGNCC 1 cut(s) 308
BmiI GGNNCC 1 cut(s) 310
BmrFI CCNGG 2 cut(s) 312, 423
BmsI GCATC 1 cut(s) 299
BpiI GAAGAC 1 cut(s) 210
BpuMI CCSGG 1 cut(s) 312
BsaBI GATNNNNATC 1 cut(s) 114
BsaI GGTCTC 1 cut(s) 60
BsaJI CCNNGG 1 cut(s) 310
BsaWI WCCGGW 1 cut(s) 199
BsaXI ACNNNNNCTCC 2 cut(s) 355, 385
Bse1I ACTGG 1 cut(s) 325
Bse8I GATNNNNATC 1 cut(s) 114
BseBI CCWGG 1 cut(s) 423
BseDI CCNNGG 1 cut(s) 310
BseJI GATNNNNATC 1 cut(s) 114
BseMII CTCAG 1 cut(s) 149
BseNI ACTGG 1 cut(s) 325
BseXI GCAGC 2 cut(s) 278, 419
BsgI GTGCAG 1 cut(s) 420
BshFI GGCC 2 cut(s) 212, 309
BsiSI CCGG 2 cut(s) 200, 312
BsmAI GTCTC 1 cut(s) 60
BsnI GGCC 2 cut(s) 212, 309
Bso31I GGTCTC 1 cut(s) 60
Bsp143I GATC 2 cut(s) 115, 235
BspANI GGCC 2 cut(s) 212, 309
BspCNI CTCAG 1 cut(s) 148
BspLI GGNNCC 1 cut(s) 310
BspTNI GGTCTC 1 cut(s) 60
BsrI ACTGG 1 cut(s) 325
BssECI CCNNGG 1 cut(s) 310
BssMI GATC 2 cut(s) 115, 235
Bst2UI CCWGG 1 cut(s) 423
Bst4CI ACNGT 3 cut(s) 341, 371, 482
Bst6I CTCTTC 1 cut(s) 34
BstAPI GCANNNNNTGC 1 cut(s) 350
BstDEI CTNAG 2 cut(s) 135, 359
BstKTI GATC 2 cut(s) 118, 238
BstMAI GTCTC 1 cut(s) 60
BstMBI GATC 2 cut(s) 115, 235
BstMWI GCNNNNNNNGC 2 cut(s) 88, 350
BstNI CCWGG 1 cut(s) 423
BstNSI RCATGY 1 cut(s) 194
BstSCI CCNGG 2 cut(s) 310, 421
BstV1I GCAGC 2 cut(s) 278, 419
BstV2I GAAGAC 1 cut(s) 210
BsuRI GGCC 2 cut(s) 212, 309
Cfr13I GGNCC 1 cut(s) 308
CviAII CATG 4 cut(s) 41, 92, 191, 262
CviJI RGCY 4 cut(s) 212, 309, 392, 410
CviKI_1 RGCY 4 cut(s) 212, 309, 392, 410
DdeI CTNAG 2 cut(s) 135, 359
DpnI GATC 2 cut(s) 117, 237
DpnII GATC 2 cut(s) 115, 235
DraI TTTAAA 1 cut(s) 451
DriI GACNNNNNGTC 1 cut(s) 469
Eam1104I CTCTTC 1 cut(s) 34
Eam1105I GACNNNNNGTC 1 cut(s) 469
EarI CTCTTC 1 cut(s) 34
Eco31I GGTCTC 1 cut(s) 60
EcoRII CCWGG 1 cut(s) 421
EcoT22I ATGCAT 1 cut(s) 250
FaeI CATG 4 cut(s) 44, 95, 194, 265
FatI CATG 4 cut(s) 40, 91, 190, 261
Fnu4HI GCNGC 2 cut(s) 267, 408
Fsp4HI GCNGC 2 cut(s) 267, 408
GluI GCNGC 2 cut(s) 267, 408
HaeIII GGCC 2 cut(s) 212, 309
HapII CCGG 2 cut(s) 200, 312
Hin1II CATG 4 cut(s) 44, 95, 194, 265
HinfI GANTC 1 cut(s) 284
HpaII CCGG 2 cut(s) 200, 312
Hpy166II GTNNAC 1 cut(s) 474
Hpy188III TCNNGA 2 cut(s) 399, 444
Hpy8I GTNNAC 1 cut(s) 474
HpyAV CCTTC 1 cut(s) 423
HpyCH4III ACNGT 3 cut(s) 341, 371, 482
HpyCH4IV ACGT 2 cut(s) 241, 277
HpyCH4V TGCA 7 cut(s) 143, 190, 233, 248, 344, 407, 437
HpyF10VI GCNNNNNNNGC 2 cut(s) 88, 350
HpyF3I CTNAG 2 cut(s) 135, 359
HpySE526I ACGT 2 cut(s) 241, 277
Hsp92II CATG 4 cut(s) 44, 95, 194, 265
Kzo9I GATC 2 cut(s) 115, 235
LpnPI CCDG 6 cut(s) 83, 213, 306, 325, 408, 435
Lsp1109I GCAGC 2 cut(s) 278, 419
LweI GCATC 1 cut(s) 299
MaeII ACGT 2 cut(s) 241, 277
MaeIII GTNAC 1 cut(s) 365
MalI GATC 2 cut(s) 117, 237
MboI GATC 2 cut(s) 115, 235
MboII GAAGA 5 cut(s) 21, 110, 174, 215, 289
MfeI CAATTG 2 cut(s) 381, 459
MluCI AATT 9 cut(s) 102, 126, 156, 270, 345, 381, 402, 453, 459
MnlI CCTC 2 cut(s) 37, 223
Mph1103I ATGCAT 1 cut(s) 250
MseI TTAA 3 cut(s) 227, 252, 450
MslI CAYNNNNRTG 1 cut(s) 260
MspI CCGG 2 cut(s) 200, 312
MspR9I CCNGG 2 cut(s) 312, 423
MunI CAATTG 2 cut(s) 381, 459
MvaI CCWGG 1 cut(s) 423
MwoI GCNNNNNNNGC 2 cut(s) 88, 350
NciI CCSGG 1 cut(s) 312
NdeII GATC 2 cut(s) 115, 235
NlaIII CATG 4 cut(s) 44, 95, 194, 265
NlaIV GGNNCC 1 cut(s) 310
NsiI ATGCAT 1 cut(s) 250
NspI RCATGY 1 cut(s) 194
PfeI GAWTC 1 cut(s) 284
PkrI GCNGC 2 cut(s) 268, 409
Psp6I CCWGG 1 cut(s) 421
PspGI CCWGG 1 cut(s) 421
PspN4I GGNNCC 1 cut(s) 310
PspPI GGNCC 1 cut(s) 308
RseI CAYNNNNRTG 1 cut(s) 260
SaqAI TTAA 3 cut(s) 227, 252, 450
SatI GCNGC 2 cut(s) 267, 408
Sau3AI GATC 2 cut(s) 115, 235
Sau96I GGNCC 1 cut(s) 308
ScrFI CCNGG 2 cut(s) 312, 423
SetI ASST 6 cut(s) 57, 72, 244, 280, 394, 412
SfaNI GCATC 1 cut(s) 299
SmiMI CAYNNNNRTG 1 cut(s) 260
Sse9I AATT 9 cut(s) 102, 126, 156, 270, 345, 381, 402, 453, 459
StyD4I CCNGG 2 cut(s) 310, 421
TaaI ACNGT 3 cut(s) 341, 371, 482
TaiI ACGT 2 cut(s) 244, 280
TasI AATT 9 cut(s) 102, 126, 156, 270, 345, 381, 402, 453, 459
TfiI GAWTC 1 cut(s) 284
Tru1I TTAA 3 cut(s) 227, 252, 450
Tru9I TTAA 3 cut(s) 227, 252, 450
TseI GCWGC 2 cut(s) 266, 407
TspDTI ATGAA 2 cut(s) 289, 297
TspGWI ACGGA 1 cut(s) 175
XapI RAATTY 1 cut(s) 453
XceI RCATGY 1 cut(s) 194
Zsp2I ATGCAT 1 cut(s) 250
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.