Rmu_sc0000663.1_g000008

Carboxylesterase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000663.1
N/A
Physical Location & Seq
Reverse (-)
36217 .. 36606
390 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 390 bp
ctgtcgcactcgtatttctggggatccaagccaatcgggtcggagcctaaaggtgaagacattgagaagtctccgcagtgtctgtgttggaatattgtttaccctggtgctgatggaggcattgacaatccattgattaatccgatggtttcgggtgctccgagtttggccgggcttgggtgctctagattgcttgtttgtgttgcaggcaaggatgagctgagggatcgaagtgtctggtattatgatttggtgaaggaaagtgggtggaaaggagaagcggagttgtttgaagtggaagaagaggggcattgtttccatatcttgtatgagaaagagaccgagaatgttgcaaaaatgatcgaacgcttggctgcttttcttgtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_3

Protein Analysis

129

Amino Acids

14.34

Weight (kDa)

4.74

Isoelectric Point (pI)

52.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Abhydrolase_3 PF07859 28 - 107 6.2e-08 alpha/beta hydrolase fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 74, 281
AclWI GGATC 3 cut(s) 18, 31, 234
AcoI YGGCCR 1 cut(s) 168
AfiI CCNNNNNNNGG 1 cut(s) 177
AgsI TTSAA 1 cut(s) 293
AjnI CCWGG 1 cut(s) 103
AluBI AGCT 1 cut(s) 220
AluI AGCT 1 cut(s) 220
Alw21I GWGCWC 2 cut(s) 160, 185
Alw26I GTCTC 2 cut(s) 75, 332
AlwI GGATC 3 cut(s) 18, 31, 234
AlwNI CAGNNNCTG 1 cut(s) 82
AoxI GGCC 1 cut(s) 168
ApeKI GCWGC 1 cut(s) 374
AseI ATTAAT 1 cut(s) 138
AsuC2I CCSGG 1 cut(s) 172
AsuHPI GGTGA 2 cut(s) 65, 265
BamHI GGATCC 1 cut(s) 23
BbsI GAAGAC 1 cut(s) 63
Bbv12I GWGCWC 2 cut(s) 160, 185
BbvCI CCTCAGC 1 cut(s) 221
BbvI GCAGC 1 cut(s) 361
BccI CCATC 2 cut(s) 107, 139
BcgI CGANNNNNNTGC 2 cut(s) 332, 366
BciT130I CCWGG 1 cut(s) 105
BcnI CCSGG 1 cut(s) 172
BcoDI GTCTC 2 cut(s) 75, 332
BfaI CTAG 2 cut(s) 186, 388
BisI GCNGC 1 cut(s) 375
BlsI GCNGC 1 cut(s) 376
Bme1390I CCNGG 2 cut(s) 105, 172
BmiI GGNNCC 2 cut(s) 25, 45
BmrFI CCNGG 2 cut(s) 105, 172
BpiI GAAGAC 1 cut(s) 63
Bpu10I CCTNAGC 1 cut(s) 221
BpuMI CCSGG 1 cut(s) 172
BsaI GGTCTC 1 cut(s) 332
BsaJI CCNNGG 1 cut(s) 103
Bsc4I CCNNNNNNNGG 1 cut(s) 177
BseBI CCWGG 1 cut(s) 105
BseDI CCNNGG 1 cut(s) 103
BseGI GGATG 1 cut(s) 220
BseLI CCNNNNNNNGG 1 cut(s) 177
BseMII CTCAG 1 cut(s) 212
BseXI GCAGC 1 cut(s) 361
BshFI GGCC 1 cut(s) 170
BsiHKAI GWGCWC 2 cut(s) 160, 185
BsiSI CCGG 1 cut(s) 171
BslI CCNNNNNNNGG 1 cut(s) 177
BsmAI GTCTC 2 cut(s) 75, 332
BsnI GGCC 1 cut(s) 170
Bso31I GGTCTC 1 cut(s) 332
Bsp1286I GDGCHC 2 cut(s) 160, 185
Bsp143I GATC 3 cut(s) 23, 226, 360
BspACI CCGC 2 cut(s) 74, 281
BspANI GGCC 1 cut(s) 170
BspCNI CTCAG 1 cut(s) 213
BspLI GGNNCC 2 cut(s) 25, 45
BspPI GGATC 3 cut(s) 18, 31, 234
BspTNI GGTCTC 1 cut(s) 332
BssECI CCNNGG 1 cut(s) 103
BssMI GATC 3 cut(s) 23, 226, 360
Bst2UI CCWGG 1 cut(s) 105
Bst6I CTCTTC 1 cut(s) 297
BstC8I GCNNGC 1 cut(s) 208
BstDEI CTNAG 1 cut(s) 221
BstF5I GGATG 1 cut(s) 220
BstKTI GATC 3 cut(s) 26, 229, 363
BstMAI GTCTC 2 cut(s) 75, 332
BstMBI GATC 3 cut(s) 23, 226, 360
BstNI CCWGG 1 cut(s) 105
BstSCI CCNGG 2 cut(s) 103, 170
BstV1I GCAGC 1 cut(s) 361
BstV2I GAAGAC 1 cut(s) 63
BstX2I RGATCY 1 cut(s) 23
BstYI RGATCY 1 cut(s) 23
BsuRI GGCC 1 cut(s) 170
BtsCI GGATG 1 cut(s) 220
BtsI GCAGTG 1 cut(s) 83
BtsIMutI CAGTG 1 cut(s) 83
Cac8I GCNNGC 1 cut(s) 208
CaiI CAGNNNCTG 1 cut(s) 82
CviJI RGCY 6 cut(s) 31, 46, 170, 175, 220, 374
CviKI_1 RGCY 6 cut(s) 31, 46, 170, 175, 220, 374
DdeI CTNAG 1 cut(s) 221
DpnI GATC 3 cut(s) 25, 228, 362
DpnII GATC 3 cut(s) 23, 226, 360
EaeI YGGCCR 1 cut(s) 168
Eam1104I CTCTTC 1 cut(s) 297
EarI CTCTTC 1 cut(s) 297
Eco31I GGTCTC 1 cut(s) 332
EcoRII CCWGG 1 cut(s) 103
FaiI YATR 3 cut(s) 246, 321, 330
Fnu4HI GCNGC 1 cut(s) 375
FokI GGATG 1 cut(s) 227
Fsp4HI GCNGC 1 cut(s) 375
FspBI CTAG 2 cut(s) 186, 388
GluI GCNGC 1 cut(s) 375
HaeIII GGCC 1 cut(s) 170
HapII CCGG 1 cut(s) 171
HpaII CCGG 1 cut(s) 171
HphI GGTGA 2 cut(s) 65, 265
Hpy166II GTNNAC 1 cut(s) 100
Hpy188I TCNGA 3 cut(s) 43, 144, 162
Hpy188III TCNNGA 1 cut(s) 186
Hpy8I GTNNAC 1 cut(s) 100
HpyAV CCTTC 1 cut(s) 250
HpyCH4V TGCA 2 cut(s) 206, 353
HpyF3I CTNAG 1 cut(s) 221
Kzo9I GATC 3 cut(s) 23, 226, 360
LmnI GCTCC 2 cut(s) 43, 163
LpnPI CCDG 6 cut(s) 4, 90, 117, 184, 192, 223
Lsp1109I GCAGC 1 cut(s) 361
MaeI CTAG 2 cut(s) 186, 388
MalI GATC 3 cut(s) 25, 228, 362
MboI GATC 3 cut(s) 23, 226, 360
MboII GAAGA 3 cut(s) 68, 311, 314
MflI RGATCY 1 cut(s) 23
MhlI GDGCHC 2 cut(s) 160, 185
MmeI TCCRAC 2 cut(s) 21, 68
MnlI CCTC 3 cut(s) 110, 216, 298
MseI TTAA 1 cut(s) 138
MspI CCGG 1 cut(s) 171
MspR9I CCNGG 2 cut(s) 105, 172
MvaI CCWGG 1 cut(s) 105
NciI CCSGG 1 cut(s) 172
NdeII GATC 3 cut(s) 23, 226, 360
NlaIV GGNNCC 2 cut(s) 25, 45
PcsI WCGNNNNNNNCGW 1 cut(s) 158
PkrI GCNGC 1 cut(s) 376
PshBI ATTAAT 1 cut(s) 138
Psp6I CCWGG 1 cut(s) 103
PspGI CCWGG 1 cut(s) 103
PspN4I GGNNCC 2 cut(s) 25, 45
PstNI CAGNNNCTG 1 cut(s) 82
PsuI RGATCY 1 cut(s) 23
SaqAI TTAA 1 cut(s) 138
SatI GCNGC 1 cut(s) 375
Sau3AI GATC 3 cut(s) 23, 226, 360
ScrFI CCNGG 2 cut(s) 105, 172
SduI GDGCHC 2 cut(s) 160, 185
SetI ASST 2 cut(s) 55, 222
SsiI CCGC 2 cut(s) 74, 281
SspI AATATT 1 cut(s) 94
SspMI CTAG 2 cut(s) 186, 388
StyD4I CCNGG 2 cut(s) 103, 170
TaqI TCGA 2 cut(s) 229, 363
TaqII GACCGA 1 cut(s) 356
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TscAI CASTG 1 cut(s) 83
TseI GCWGC 1 cut(s) 374
TspRI CASTG 1 cut(s) 83
VspI ATTAAT 1 cut(s) 138
XbaI TCTAGA 1 cut(s) 185
XspI CTAG 2 cut(s) 186, 388
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.