Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000689.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

110718 .. 112110

Gene Structure 1393 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000689.1_g000029.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 429 bp

atgagatttcaggcaacctccggcgaggccacaaaagctattgtcacaaacattaaaagctactctgatgaaatttcagggaccttctatgaggtcacaaaagttactgtcaccaacactaaaagctactcccaccaacagcaaatattactgtcactagcaacaaaagctattctaatgagttctccgaccttctgctccgggacctcaatatggctgagcggggcccacgaacttcagttcaacaaatgcgagagagccaaagaggcccaaatccacgggatcgagaccttgatctgcatcctaacttccgacggtgtccttgaaatgggttcctccggtttgatcagagagaaccgggggttgatccagcaagccaagtcattgttcgggtcggataagcccgacccggaaacaagaccgctctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0006355 GO:0008150 GO:0009889 GO:0009892 GO:0010468 GO:0010556 GO:0010605 GO:0010629 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0048519 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

ko04016 ko04075 map04016 map04075

Pfam Domains

Protein Families

HLH bHLH-MYC_N

Protein Analysis

142

Amino Acids

15.53

Weight (kDa)

6.82

Isoelectric Point (pI)

31.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	2 cut(s)	222, 424
AciI	CCGC	2 cut(s)	222, 422
AclWI	GGATC	2 cut(s)	290, 361
AcsI	RAATTY	1 cut(s)	72
AcuI	CTGAAG	1 cut(s)	221
AfiI	CCNNNNNNNGG	2 cut(s)	213, 328
AgsI	TTSAA	2 cut(s)	244, 326
AjuI	GAANNNNNNNTTGG	2 cut(s)	371, 403
AluBI	AGCT	4 cut(s)	38, 60, 126, 170
AluI	AGCT	4 cut(s)	38, 60, 126, 170
Alw26I	GTCTC	1 cut(s)	281
AlwI	GGATC	2 cut(s)	290, 361
AoxI	GGCC	3 cut(s)	27, 225, 267
ApaI	GGGCCC	1 cut(s)	229
ApoI	RAATTY	1 cut(s)	72
AspS9I	GGNCC	5 cut(s)	81, 204, 225, 226, 268
AsuC2I	CCSGG	3 cut(s)	202, 359, 410
AsuHPI	GGTGA	1 cut(s)	103
AvaII	GGWCC	2 cut(s)	81, 204
BaeGI	GKGCMC	1 cut(s)	229
BanII	GRGCYC	1 cut(s)	229
BclI	TGATCA	1 cut(s)	345
BcnI	CCSGG	3 cut(s)	202, 359, 410
BcoDI	GTCTC	1 cut(s)	281
BfaI	CTAG	2 cut(s)	158, 427
BglI	GCCNNNNNGGC	1 cut(s)	266
BlpI	GCTNAGC	1 cut(s)	218
Bme1390I	CCNGG	3 cut(s)	202, 359, 410
Bme18I	GGWCC	2 cut(s)	81, 204
BmgT120I	GGNCC	5 cut(s)	81, 204, 225, 226, 268
BmiI	GGNNCC	5 cut(s)	82, 205, 226, 227, 334
BmrFI	CCNGG	3 cut(s)	202, 359, 410
BmsI	GCATC	1 cut(s)	309
Bpu1102I	GCTNAGC	1 cut(s)	218
BpuMI	CCSGG	3 cut(s)	202, 359, 410
BsaBI	GATNNNNATC	1 cut(s)	299
BsaI	GGTCTC	1 cut(s)	281
BsaJI	CCNNGG	2 cut(s)	277, 358
BsaWI	WCCGGW	1 cut(s)	338
Bsc4I	CCNNNNNNNGG	2 cut(s)	213, 328
Bse8I	GATNNNNATC	1 cut(s)	299
BseDI	CCNNGG	2 cut(s)	277, 358
BseGI	GGATG	1 cut(s)	300
BseJI	GATNNNNATC	1 cut(s)	299
BseLI	CCNNNNNNNGG	2 cut(s)	213, 328
BseMII	CTCAG	1 cut(s)	209
BseSI	GKGCMC	1 cut(s)	229
BshFI	GGCC	3 cut(s)	29, 227, 269
BsiSI	CCGG	5 cut(s)	21, 201, 339, 358, 410
BslFI	GGGAC	2 cut(s)	94, 217
BslI	CCNNNNNNNGG	2 cut(s)	213, 328
BsmAI	GTCTC	1 cut(s)	281
BsmFI	GGGAC	2 cut(s)	94, 217
BsnI	GGCC	3 cut(s)	29, 227, 269
Bso31I	GGTCTC	1 cut(s)	281
Bsp120I	GGGCCC	1 cut(s)	225
Bsp1286I	GDGCHC	1 cut(s)	229
Bsp143I	GATC	4 cut(s)	282, 294, 345, 366
Bsp1720I	GCTNAGC	1 cut(s)	218
BspACI	CCGC	2 cut(s)	222, 422
BspANI	GGCC	3 cut(s)	29, 227, 269
BspCNI	CTCAG	1 cut(s)	210
BspLI	GGNNCC	5 cut(s)	82, 205, 226, 227, 334
BspPI	GGATC	2 cut(s)	290, 361
BspTNI	GGTCTC	1 cut(s)	281
BsrBI	CCGCTC	2 cut(s)	222, 424
BssECI	CCNNGG	2 cut(s)	277, 358
BssMI	GATC	4 cut(s)	282, 294, 345, 366
Bst4CI	ACNGT	3 cut(s)	109, 153, 317
BstC8I	GCNNGC	1 cut(s)	375
BstDEI	CTNAG	1 cut(s)	218
BstDSI	CCRYGG	1 cut(s)	277
BstF5I	GGATG	1 cut(s)	300
BstKTI	GATC	4 cut(s)	285, 297, 348, 369
BstMAI	GTCTC	1 cut(s)	281
BstMBI	GATC	4 cut(s)	282, 294, 345, 366
BstMWI	GCNNNNNNNGC	3 cut(s)	35, 167, 266
BstSCI	CCNGG	3 cut(s)	200, 357, 408
BstSLI	GKGCMC	1 cut(s)	229
BsuRI	GGCC	3 cut(s)	29, 227, 269
BtgI	CCRYGG	1 cut(s)	277
BtsCI	GGATG	1 cut(s)	300
Cac8I	GCNNGC	1 cut(s)	375
Cfr13I	GGNCC	5 cut(s)	81, 204, 225, 226, 268
DdeI	CTNAG	1 cut(s)	218
DpnI	GATC	4 cut(s)	284, 296, 347, 368
DpnII	GATC	4 cut(s)	282, 294, 345, 366
Eco24I	GRGCYC	1 cut(s)	229
Eco31I	GGTCTC	1 cut(s)	281
Eco47I	GGWCC	2 cut(s)	81, 204
Eco57I	CTGAAG	1 cut(s)	221
EcoO109I	RGGNCCY	3 cut(s)	81, 204, 225
EcoT38I	GRGCYC	1 cut(s)	229
FaiI	YATR	2 cut(s)	90, 214
FaqI	GGGAC	2 cut(s)	94, 217
FauI	CCCGC	1 cut(s)	215
FbaI	TGATCA	1 cut(s)	345
FokI	GGATG	1 cut(s)	287
FriOI	GRGCYC	1 cut(s)	229
FspBI	CTAG	2 cut(s)	158, 427
HaeIII	GGCC	3 cut(s)	29, 227, 269
HapII	CCGG	5 cut(s)	21, 201, 339, 358, 410
HpaII	CCGG	5 cut(s)	21, 201, 339, 358, 410
HphI	GGTGA	1 cut(s)	103
Hpy188I	TCNGA	5 cut(s)	67, 189, 313, 350, 397
Hpy188III	TCNNGA	1 cut(s)	286
Hpy99I	CGWCG	1 cut(s)	317
HpyAV	CCTTC	2 cut(s)	94, 202
HpyCH4III	ACNGT	3 cut(s)	109, 153, 317
HpyCH4V	TGCA	1 cut(s)	300
HpyF10VI	GCNNNNNNNGC	3 cut(s)	35, 167, 266
HpyF3I	CTNAG	1 cut(s)	218
Ksp22I	TGATCA	1 cut(s)	345
Kzo9I	GATC	4 cut(s)	282, 294, 345, 366
LmnI	GCTCC	1 cut(s)	203
LpnPI	CCDG	7 cut(s)	34, 63, 214, 352, 371, 383, 423
LweI	GCATC	1 cut(s)	309
MaeI	CTAG	2 cut(s)	158, 427
MaeIII	GTNAC	5 cut(s)	43, 94, 103, 109, 153
MalI	GATC	4 cut(s)	284, 296, 347, 368
MbiI	CCGCTC	2 cut(s)	222, 424
MboI	GATC	4 cut(s)	282, 294, 345, 366
MhlI	GDGCHC	1 cut(s)	229
MluCI	AATT	1 cut(s)	72
MmeI	TCCRAC	3 cut(s)	212, 336, 375
MnlI	CCTC	6 cut(s)	19, 28, 85, 217, 259, 346
MseI	TTAA	1 cut(s)	54
MspI	CCGG	5 cut(s)	21, 201, 339, 358, 410
MspR9I	CCNGG	3 cut(s)	202, 359, 410
MwoI	GCNNNNNNNGC	3 cut(s)	35, 167, 266
NciI	CCSGG	3 cut(s)	202, 359, 410
NdeII	GATC	4 cut(s)	282, 294, 345, 366
NlaIV	GGNNCC	5 cut(s)	82, 205, 226, 227, 334
NmuCI	GTSAC	4 cut(s)	43, 94, 109, 153
PflFI	GACNNNGTC	1 cut(s)	317
PfoI	TCCNGGA	1 cut(s)	200
PpuMI	RGGWCCY	2 cut(s)	81, 204
Psp5II	RGGWCCY	2 cut(s)	81, 204
PspN4I	GGNNCC	5 cut(s)	82, 205, 226, 227, 334
PspOMI	GGGCCC	1 cut(s)	225
PspPI	GGNCC	5 cut(s)	81, 204, 225, 226, 268
PspPPI	RGGWCCY	2 cut(s)	81, 204
PsyI	GACNNNGTC	1 cut(s)	317
SaqAI	TTAA	1 cut(s)	54
Sau3AI	GATC	4 cut(s)	282, 294, 345, 366
Sau96I	GGNCC	5 cut(s)	81, 204, 225, 226, 268
ScrFI	CCNGG	3 cut(s)	202, 359, 410
SduI	GDGCHC	1 cut(s)	229
SfaNI	GCATC	1 cut(s)	309
SinI	GGWCC	2 cut(s)	81, 204
Sse9I	AATT	1 cut(s)	72
SsiI	CCGC	2 cut(s)	222, 422
SspI	AATATT	1 cut(s)	147
SspMI	CTAG	2 cut(s)	158, 427
StyD4I	CCNGG	3 cut(s)	200, 357, 408
TaaI	ACNGT	3 cut(s)	109, 153, 317
TaqI	TCGA	1 cut(s)	285
TasI	AATT	1 cut(s)	72
Tru1I	TTAA	1 cut(s)	54
Tru9I	TTAA	1 cut(s)	54
TseFI	GTSAC	4 cut(s)	43, 94, 109, 153
Tsp45I	GTSAC	4 cut(s)	43, 94, 109, 153
TspDTI	ATGAA	1 cut(s)	84
Tth111I	GACNNNGTC	1 cut(s)	317
VpaK11BI	GGWCC	2 cut(s)	81, 204
XapI	RAATTY	1 cut(s)	72
XspI	CTAG	2 cut(s)	158, 427

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.