Rmu_sc0000751.1_g000009

receptor-like protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000751.1
N/A
Physical Location & Seq
Reverse (-)
22979 .. 23965
987 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000751.1_g000009.1.cds

Sequence Viewer

Length: 609 bp
atgaggtcctacaccgaagggcgactgcctctctgcggagcctccgcttgcacggttaacgttaaccgctggattgacgttgatcattgggttggtgggatgggggttggcggactgattcgcctgctcctcagcgtttccctcgctactattagtcatggtggatgtggtgggatggccttttgttcaaggattcccacagacggcgccaatagtttcctctacctgtcaaatgaaatacaaagggcatcagagggagaccacgttgggcgtccccaacttctggagcttctgatgctgtcttggcgtggagcgtggcggcgcatcagcggtgatctgggggcaagtcggggctcatgcggtagcctgcttggctgtgttcccgtagctaattatgcttacaaatgcctatctaagaacacaaagcttaaagaggctcatgaggacagcacaaacattgatgcttcatcagcagcattctctttgccaaatgttcagcgttttccttcacttggttcgacgaggaatggagatgatatcagggaagccgacttggacgcaacagaaagtgaaattttctctcaattgaaaattggtgatgccagataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Malectin_like Pkinase Pkinase_Tyr

Protein Analysis

202

Amino Acids

21.65

Weight (kDa)

6.41

Isoelectric Point (pI)

39.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 206
AccB7I CCANNNNNTGG 1 cut(s) 283
AciI CCGC 7 cut(s) 36, 45, 67, 111, 319, 330, 360
AclI AACGTT 1 cut(s) 60
AcsI RAATTY 1 cut(s) 573
AcyI GRCGYC 2 cut(s) 207, 271
AfiI CCNNNNNNNGG 4 cut(s) 35, 203, 283, 512
AgsI TTSAA 2 cut(s) 189, 589
AluBI AGCT 3 cut(s) 289, 389, 427
AluI AGCT 3 cut(s) 289, 389, 427
Alw26I GTCTC 1 cut(s) 252
AoxI GGCC 1 cut(s) 177
ApeKI GCWGC 1 cut(s) 473
ApoI RAATTY 1 cut(s) 573
AspLEI GCGC 2 cut(s) 209, 324
AspS9I GGNCC 1 cut(s) 6
AsuHPI GGTGA 2 cut(s) 344, 608
AvaII GGWCC 1 cut(s) 6
BanI GGYRCC 1 cut(s) 206
BanII GRGCYC 1 cut(s) 356
BbvCI CCTCAGC 1 cut(s) 131
BbvI GCAGC 1 cut(s) 485
BccI CCATC 2 cut(s) 94, 169
BceAI ACGGC 1 cut(s) 220
BclI TGATCA 1 cut(s) 82
BcoDI GTCTC 1 cut(s) 252
BfoI RGCGCY 1 cut(s) 210
BglI GCCNNNNNGGC 1 cut(s) 372
BisI GCNGC 2 cut(s) 320, 474
BlsI GCNGC 2 cut(s) 321, 475
Bme18I GGWCC 1 cut(s) 6
BmgT120I GGNCC 1 cut(s) 6
BmiI GGNNCC 2 cut(s) 40, 208
BmsI GCATC 5 cut(s) 257, 285, 333, 451, 589
BpmI CTGGAG 1 cut(s) 305
Bpu10I CCTNAGC 1 cut(s) 131
BsaHI GRCGYC 2 cut(s) 207, 271
BsaI GGTCTC 1 cut(s) 252
BsaXI ACNNNNNCTCC 2 cut(s) 249, 279
Bsc4I CCNNNNNNNGG 4 cut(s) 35, 203, 283, 512
BseGI GGATG 3 cut(s) 105, 170, 180
BseLI CCNNNNNNNGG 4 cut(s) 35, 203, 283, 512
BseMII CTCAG 1 cut(s) 145
BseRI GAGGAG 1 cut(s) 119
BseXI GCAGC 1 cut(s) 485
BshFI GGCC 1 cut(s) 179
BshNI GGYRCC 1 cut(s) 206
BslFI GGGAC 1 cut(s) 258
BslI CCNNNNNNNGG 4 cut(s) 35, 203, 283, 512
BsmAI GTCTC 1 cut(s) 252
BsmFI GGGAC 1 cut(s) 258
BsmI GAATGC 1 cut(s) 476
BsnI GGCC 1 cut(s) 179
Bso31I GGTCTC 1 cut(s) 252
Bsp1286I GDGCHC 1 cut(s) 356
Bsp143I GATC 2 cut(s) 82, 334
BspACI CCGC 7 cut(s) 36, 45, 67, 111, 319, 330, 360
BspANI GGCC 1 cut(s) 179
BspCNI CTCAG 1 cut(s) 144
BspHI TCATGA 1 cut(s) 439
BspLI GGNNCC 2 cut(s) 40, 208
BspT107I GGYRCC 1 cut(s) 206
BspTNI GGTCTC 1 cut(s) 252
BssMI GATC 2 cut(s) 82, 334
BssNI GRCGYC 2 cut(s) 207, 271
Bst4CI ACNGT 1 cut(s) 55
BstACI GRCGYC 2 cut(s) 207, 271
BstC8I GCNNGC 3 cut(s) 49, 125, 368
BstDEI CTNAG 2 cut(s) 131, 414
BstF5I GGATG 3 cut(s) 105, 170, 180
BstH2I RGCGCY 1 cut(s) 210
BstHHI GCGC 2 cut(s) 209, 324
BstKTI GATC 2 cut(s) 85, 337
BstMAI GTCTC 1 cut(s) 252
BstMBI GATC 2 cut(s) 82, 334
BstMWI GCNNNNNNNGC 5 cut(s) 295, 304, 372, 395, 470
BstV1I GCAGC 1 cut(s) 485
BsuRI GGCC 1 cut(s) 179
BtsCI GGATG 3 cut(s) 105, 170, 180
Cac8I GCNNGC 3 cut(s) 49, 125, 368
CciI TCATGA 1 cut(s) 439
CfoI GCGC 2 cut(s) 209, 324
Cfr13I GGNCC 1 cut(s) 6
CseI GACGC 2 cut(s) 260, 566
CviAII CATG 3 cut(s) 158, 357, 440
DdeI CTNAG 2 cut(s) 131, 414
DinI GGCGCC 1 cut(s) 208
DpnI GATC 2 cut(s) 84, 336
DpnII GATC 2 cut(s) 82, 334
EciI GGCGGA 1 cut(s) 126
Eco24I GRGCYC 1 cut(s) 356
Eco31I GGTCTC 1 cut(s) 252
Eco32I GATATC 1 cut(s) 538
Eco47I GGWCC 1 cut(s) 6
EcoO109I RGGNCCY 1 cut(s) 6
EcoRV GATATC 1 cut(s) 538
EcoT38I GRGCYC 1 cut(s) 356
EgeI GGCGCC 1 cut(s) 208
EheI GGCGCC 1 cut(s) 208
FaeI CATG 3 cut(s) 161, 360, 443
FaiI YATR 4 cut(s) 159, 358, 396, 441
FaqI GGGAC 1 cut(s) 258
FatI CATG 3 cut(s) 157, 356, 439
FbaI TGATCA 1 cut(s) 82
Fnu4HI GCNGC 2 cut(s) 320, 474
FokI GGATG 3 cut(s) 112, 177, 187
FriOI GRGCYC 1 cut(s) 356
Fsp4HI GCNGC 2 cut(s) 320, 474
GlaI GCGC 2 cut(s) 208, 323
GluI GCNGC 2 cut(s) 320, 474
GsuI CTGGAG 1 cut(s) 305
HaeII RGCGCY 1 cut(s) 210
HaeIII GGCC 1 cut(s) 179
HgaI GACGC 2 cut(s) 260, 566
HhaI GCGC 2 cut(s) 209, 324
Hin1I GRCGYC 2 cut(s) 207, 271
Hin1II CATG 3 cut(s) 161, 360, 443
Hin6I GCGC 2 cut(s) 207, 322
HinP1I GCGC 2 cut(s) 207, 322
HincII GTYRAC 2 cut(s) 58, 64
HindII GTYRAC 2 cut(s) 58, 64
HindIII AAGCTT 1 cut(s) 425
HinfI GANTC 2 cut(s) 118, 193
HpaI GTTAAC 2 cut(s) 58, 64
HphI GGTGA 2 cut(s) 344, 608
Hpy166II GTNNAC 2 cut(s) 58, 64
Hpy188I TCNGA 2 cut(s) 253, 294
Hpy188III TCNNGA 2 cut(s) 284, 440
Hpy8I GTNNAC 2 cut(s) 58, 64
Hpy99I CGWCG 1 cut(s) 523
HpyAV CCTTC 2 cut(s) 11, 516
HpyCH4III ACNGT 1 cut(s) 55
HpyCH4IV ACGT 3 cut(s) 60, 78, 264
HpyCH4V TGCA 1 cut(s) 51
HpyF10VI GCNNNNNNNGC 5 cut(s) 295, 304, 372, 395, 470
HpyF3I CTNAG 2 cut(s) 131, 414
HpySE526I ACGT 3 cut(s) 60, 78, 264
Hsp92I GRCGYC 2 cut(s) 207, 271
Hsp92II CATG 3 cut(s) 161, 360, 443
HspAI GCGC 2 cut(s) 207, 322
KasI GGCGCC 1 cut(s) 206
Ksp22I TGATCA 1 cut(s) 82
KspAI GTTAAC 2 cut(s) 58, 64
Kzo9I GATC 2 cut(s) 82, 334
LmnI GCTCC 4 cut(s) 38, 132, 286, 311
LpnPI CCDG 7 cut(s) 55, 137, 239, 269, 323, 380, 526
Lsp1109I GCAGC 1 cut(s) 485
LweI GCATC 5 cut(s) 257, 285, 333, 451, 589
MaeII ACGT 3 cut(s) 60, 78, 264
MalI GATC 2 cut(s) 84, 336
MboI GATC 2 cut(s) 82, 334
MfeI CAATTG 1 cut(s) 584
MhlI GDGCHC 1 cut(s) 356
MluCI AATT 4 cut(s) 391, 573, 584, 591
Mly113I GGCGCC 1 cut(s) 207
MnlI CCTC 9 cut(s) 39, 52, 140, 152, 230, 247, 427, 436, 516
MseI TTAA 3 cut(s) 57, 63, 429
MspA1I CMGCKG 2 cut(s) 69, 330
MunI CAATTG 1 cut(s) 584
Mva1269I GAATGC 1 cut(s) 476
MwoI GCNNNNNNNGC 5 cut(s) 295, 304, 372, 395, 470
NarI GGCGCC 1 cut(s) 207
NdeII GATC 2 cut(s) 82, 334
NlaIII CATG 3 cut(s) 161, 360, 443
NlaIV GGNNCC 2 cut(s) 40, 208
PagI TCATGA 1 cut(s) 439
PctI GAATGC 1 cut(s) 476
PfeI GAWTC 2 cut(s) 118, 193
PflMI CCANNNNNTGG 1 cut(s) 283
PkrI GCNGC 2 cut(s) 321, 475
PluTI GGCGCC 1 cut(s) 210
PpuMI RGGWCCY 1 cut(s) 6
Psp1406I AACGTT 1 cut(s) 60
Psp5II RGGWCCY 1 cut(s) 6
PspN4I GGNNCC 2 cut(s) 40, 208
PspPI GGNCC 1 cut(s) 6
PspPPI RGGWCCY 1 cut(s) 6
SaqAI TTAA 3 cut(s) 57, 63, 429
SatI GCNGC 2 cut(s) 320, 474
Sau3AI GATC 2 cut(s) 82, 334
Sau96I GGNCC 1 cut(s) 6
SduI GDGCHC 1 cut(s) 356
SetI ASST 8 cut(s) 8, 63, 81, 228, 267, 291, 391, 429
SfaNI GCATC 5 cut(s) 257, 285, 333, 451, 589
SfoI GGCGCC 1 cut(s) 208
SinI GGWCC 1 cut(s) 6
Sse9I AATT 4 cut(s) 391, 573, 584, 591
SsiI CCGC 7 cut(s) 36, 45, 67, 111, 319, 330, 360
SspDI GGCGCC 1 cut(s) 206
TaaI ACNGT 1 cut(s) 55
TaiI ACGT 3 cut(s) 63, 81, 267
TaqI TCGA 1 cut(s) 518
TasI AATT 4 cut(s) 391, 573, 584, 591
TauI GCSGC 1 cut(s) 322
TfiI GAWTC 2 cut(s) 118, 193
Tru1I TTAA 3 cut(s) 57, 63, 429
Tru9I TTAA 3 cut(s) 57, 63, 429
TseI GCWGC 1 cut(s) 473
TspDTI ATGAA 2 cut(s) 249, 456
Van91I CCANNNNNTGG 1 cut(s) 283
VpaK11BI GGWCC 1 cut(s) 6
XapI RAATTY 1 cut(s) 573
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.