Rmu_sc0000761.1_g000022

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000761.1
N/A
Physical Location & Seq
Reverse (-)
94788 .. 95186
399 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 399 bp
ctgcttcagttgaagacacccaaagaactgtgggatgcccttaagggacgttttgggaacattcacgatactttgctcccaggactggctattaagtggaatggaatccgcttgcttgactgtaaaagggtcacagacttcaacaaggacctattgcgcttaaaggcatgtctcaatttctgtggaaggaaaatcatagaatatgatatgatctacaagagcctttccacctttcctacttcagcgtttatgctagcggacaactataggctggagtttgacaacaaaagaatcacaaccttcaataagttgatcagcctactgcaagtggctgagaggcaaaatgaggttatcttgtacaataatgctaggcccattgggacaaagaaaattccatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

132

Amino Acids

15.35

Weight (kDa)

9.68

Isoelectric Point (pI)

39.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 109, 257
AcsI RAATTY 1 cut(s) 390
AcuI CTGAAG 1 cut(s) 225
AfaI GTAC 1 cut(s) 359
AfiI CCNNNNNNNGG 1 cut(s) 85
AflII CTTAAG 1 cut(s) 41
AgsI TTSAA 3 cut(s) 13, 142, 304
AjnI CCWGG 1 cut(s) 79
Alw26I GTCTC 1 cut(s) 176
AoxI GGCC 1 cut(s) 371
ApoI RAATTY 1 cut(s) 390
AspLEI GCGC 1 cut(s) 159
AspS9I GGNCC 2 cut(s) 148, 372
AsuNHI GCTAGC 1 cut(s) 253
AvaII GGWCC 1 cut(s) 148
BbsI GAAGAC 1 cut(s) 20
BciT130I CCWGG 1 cut(s) 81
BclI TGATCA 1 cut(s) 312
BcoDI GTCTC 1 cut(s) 176
BfaI CTAG 2 cut(s) 254, 369
BfmI CTRYAG 1 cut(s) 265
BfrI CTTAAG 1 cut(s) 41
Bme1390I CCNGG 1 cut(s) 81
Bme18I GGWCC 1 cut(s) 148
BmgT120I GGNCC 2 cut(s) 148, 372
BmrFI CCNGG 1 cut(s) 81
BmsI GCATC 1 cut(s) 25
BmtI GCTAGC 1 cut(s) 257
BpiI GAAGAC 1 cut(s) 20
BpmI CTGGAG 1 cut(s) 293
BsaJI CCNNGG 1 cut(s) 79
Bsc4I CCNNNNNNNGG 1 cut(s) 85
Bse1I ACTGG 1 cut(s) 90
BseBI CCWGG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 79
BseGI GGATG 1 cut(s) 40
BseLI CCNNNNNNNGG 1 cut(s) 85
BseMII CTCAG 1 cut(s) 324
BseNI ACTGG 1 cut(s) 90
BshFI GGCC 1 cut(s) 373
BslFI GGGAC 2 cut(s) 60, 394
BslI CCNNNNNNNGG 1 cut(s) 85
BsmAI GTCTC 1 cut(s) 176
BsmFI GGGAC 2 cut(s) 60, 394
BsnI GGCC 1 cut(s) 373
Bsp1407I TGTACA 1 cut(s) 357
Bsp143I GATC 2 cut(s) 210, 312
BspACI CCGC 2 cut(s) 109, 257
BspANI GGCC 1 cut(s) 373
BspCNI CTCAG 1 cut(s) 325
BspOI GCTAGC 1 cut(s) 257
BspTI CTTAAG 1 cut(s) 41
BsrGI TGTACA 1 cut(s) 357
BsrI ACTGG 1 cut(s) 90
BssECI CCNNGG 1 cut(s) 79
BssMI GATC 2 cut(s) 210, 312
Bst2UI CCWGG 1 cut(s) 81
Bst4CI ACNGT 2 cut(s) 30, 122
BstAFI CTTAAG 1 cut(s) 41
BstAUI TGTACA 1 cut(s) 357
BstC8I GCNNGC 2 cut(s) 113, 255
BstDEI CTNAG 1 cut(s) 333
BstF5I GGATG 1 cut(s) 40
BstHHI GCGC 1 cut(s) 159
BstKTI GATC 2 cut(s) 213, 315
BstMAI GTCTC 1 cut(s) 176
BstMBI GATC 2 cut(s) 210, 312
BstNI CCWGG 1 cut(s) 81
BstNSI RCATGY 1 cut(s) 171
BstSCI CCNGG 1 cut(s) 79
BstSFI CTRYAG 1 cut(s) 265
BstV2I GAAGAC 1 cut(s) 20
BsuRI GGCC 1 cut(s) 373
BtsCI GGATG 1 cut(s) 40
Cac8I GCNNGC 2 cut(s) 113, 255
CfoI GCGC 1 cut(s) 159
Cfr13I GGNCC 2 cut(s) 148, 372
Csp6I GTAC 1 cut(s) 358
CspCI CAANNNNNGTGG 2 cut(s) 163, 198
CviAII CATG 1 cut(s) 168
CviJI RGCY 6 cut(s) 89, 222, 271, 318, 332, 373
CviKI_1 RGCY 6 cut(s) 89, 222, 271, 318, 332, 373
CviQI GTAC 1 cut(s) 358
DdeI CTNAG 1 cut(s) 333
DpnI GATC 2 cut(s) 212, 314
DpnII GATC 2 cut(s) 210, 312
Eco47I GGWCC 1 cut(s) 148
Eco57I CTGAAG 1 cut(s) 225
EcoO109I RGGNCCY 1 cut(s) 148
EcoRII CCWGG 1 cut(s) 79
FaeI CATG 1 cut(s) 171
FaiI YATR 7 cut(s) 169, 197, 204, 209, 251, 267, 397
FaqI GGGAC 2 cut(s) 60, 394
FatI CATG 1 cut(s) 167
FbaI TGATCA 1 cut(s) 312
FokI GGATG 1 cut(s) 47
FspBI CTAG 2 cut(s) 254, 369
GlaI GCGC 1 cut(s) 158
GsuI CTGGAG 1 cut(s) 293
HaeIII GGCC 1 cut(s) 373
HhaI GCGC 1 cut(s) 159
Hin1II CATG 1 cut(s) 171
Hin6I GCGC 1 cut(s) 157
HinP1I GCGC 1 cut(s) 157
HinfI GANTC 2 cut(s) 105, 291
Hpy188III TCNNGA 1 cut(s) 65
HpyAV CCTTC 2 cut(s) 180, 310
HpyCH4III ACNGT 2 cut(s) 30, 122
HpyCH4IV ACGT 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 325
HpyF3I CTNAG 1 cut(s) 333
HpySE526I ACGT 1 cut(s) 49
Hsp92II CATG 1 cut(s) 171
HspAI GCGC 1 cut(s) 157
Ksp22I TGATCA 1 cut(s) 312
Kzo9I GATC 2 cut(s) 210, 312
LmnI GCTCC 1 cut(s) 81
LpnPI CCDG 4 cut(s) 66, 71, 93, 257
LweI GCATC 1 cut(s) 25
MaeI CTAG 2 cut(s) 254, 369
MaeII ACGT 1 cut(s) 49
MaeIII GTNAC 1 cut(s) 130
MalI GATC 2 cut(s) 212, 314
MboI GATC 2 cut(s) 210, 312
MboII GAAGA 1 cut(s) 25
MluCI AATT 2 cut(s) 175, 390
MnlI CCTC 2 cut(s) 330, 340
MseI TTAA 3 cut(s) 42, 93, 161
MspCI CTTAAG 1 cut(s) 41
MspR9I CCNGG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 81
NdeII GATC 2 cut(s) 210, 312
NheI GCTAGC 1 cut(s) 253
NlaIII CATG 1 cut(s) 171
NmuCI GTSAC 1 cut(s) 130
NspI RCATGY 1 cut(s) 171
PfeI GAWTC 2 cut(s) 105, 291
PpuMI RGGWCCY 1 cut(s) 148
Psp5II RGGWCCY 1 cut(s) 148
Psp6I CCWGG 1 cut(s) 79
PspGI CCWGG 1 cut(s) 79
PspPI GGNCC 2 cut(s) 148, 372
PspPPI RGGWCCY 1 cut(s) 148
RsaI GTAC 1 cut(s) 359
RsaNI GTAC 1 cut(s) 358
SaqAI TTAA 3 cut(s) 42, 93, 161
Sau3AI GATC 2 cut(s) 210, 312
Sau96I GGNCC 2 cut(s) 148, 372
ScrFI CCNGG 1 cut(s) 81
SetI ASST 5 cut(s) 52, 153, 233, 302, 351
SfaNI GCATC 1 cut(s) 25
SfcI CTRYAG 1 cut(s) 265
SinI GGWCC 1 cut(s) 148
SmlI CTYRAG 1 cut(s) 41
SmoI CTYRAG 1 cut(s) 41
Sse9I AATT 2 cut(s) 175, 390
SsiI CCGC 2 cut(s) 109, 257
SspMI CTAG 2 cut(s) 254, 369
StyD4I CCNGG 1 cut(s) 79
TaaI ACNGT 2 cut(s) 30, 122
TaiI ACGT 1 cut(s) 52
TasI AATT 2 cut(s) 175, 390
TatI WGTACW 1 cut(s) 357
TfiI GAWTC 2 cut(s) 105, 291
Tru1I TTAA 3 cut(s) 42, 93, 161
Tru9I TTAA 3 cut(s) 42, 93, 161
TseFI GTSAC 1 cut(s) 130
Tsp45I GTSAC 1 cut(s) 130
Vha464I CTTAAG 1 cut(s) 41
VpaK11BI GGWCC 1 cut(s) 148
XapI RAATTY 1 cut(s) 390
XceI RCATGY 1 cut(s) 171
XspI CTAG 2 cut(s) 254, 369
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.