Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000762.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

161193 .. 163207

Gene Structure 2015 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 813 bp

atgtttaaaggatctgatgaaattcaaggactcactctagacttgtggttaggggaaaaggttgaatttaggacagaagcatttgtaaaaatattgaagagactgagacttctcgaactcaatggtgtagagcttattggatgctgcaaatatctccccaacaagttaatatggctccgctggactagcttccctctagagtccataccaaaagactttagtctagaagaagcagttgctatctacctgcgaattagcaacctcagacacgtttgggaagattctggggtccttacgaaattgaagattcttgatctcagtcattcctcttacttaaaaaaatcacctgacttttcaactattcccaatctcgaggagttattcctcacaaactgtgggcaattggcagaggttcaccagttcattggaggactgaaaaggctttcttatgttgatcttacggactgcgaaattcttgaggagcttccaaggagtttctataagttaaaatctgtagtaactcttgttcttaatggctgtgcaagatttgagaaattggacgaggaaataggggacatgacatcgttgtctactctcggtgcagatcgcactgccataacagaactgccgtcttccattgtgagattaaagaacctgagatgtttatctctagtggattctttttatggatattatcaattaagctctatcaatagctgcaaaatagcacgacgcttgtattgctctcccacaaccccgtttccacggtttctccggcgaaagaggggatatctcgatcgggaaagaagataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0006950 GO:0006974 GO:0008150 GO:0009987 GO:0033554 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0050896 GO:0051716

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

PITH

Protein Analysis

270

Amino Acids

31.17

Weight (kDa)

8.7

Isoelectric Point (pI)

46.21

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
LRR_14	PF23598	182 - 224	1.3e-07	Leucine-rich repeat region

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	586
Acc36I	ACCTGC	1 cut(s)	255
AccI	GTMKAC	1 cut(s)	590
AciI	CCGC	1 cut(s)	178
AclWI	GGATC	1 cut(s)	19
AcsI	RAATTY	3 cut(s)	21, 65, 471
AflIII	ACRYGT	1 cut(s)	268
AgsI	TTSAA	5 cut(s)	26, 65, 97, 304, 357
AluBI	AGCT	5 cut(s)	133, 189, 484, 705, 717
AluI	AGCT	5 cut(s)	133, 189, 484, 705, 717
Alw26I	GTCTC	2 cut(s)	94, 100
AlwI	GGATC	1 cut(s)	19
Ama87I	CYCGRG	1 cut(s)	371
ApeKI	GCWGC	2 cut(s)	144, 717
ApoI	RAATTY	3 cut(s)	21, 65, 471
AspS9I	GGNCC	1 cut(s)	289
AsuHPI	GGTGA	2 cut(s)	336, 407
AvaI	CYCGRG	1 cut(s)	371
AvaII	GGWCC	1 cut(s)	289
BbsI	GAAGAC	1 cut(s)	624
BbvI	GCAGC	2 cut(s)	131, 704
BceAI	ACGGC	1 cut(s)	613
BcoDI	GTCTC	2 cut(s)	94, 100
BfaI	CTAG	5 cut(s)	38, 186, 197, 224, 671
BfmI	CTRYAG	1 cut(s)	513
BfuAI	ACCTGC	1 cut(s)	255
BisI	GCNGC	2 cut(s)	145, 718
BlsI	GCNGC	2 cut(s)	146, 719
Bme18I	GGWCC	1 cut(s)	289
BmeT110I	CYCGRG	1 cut(s)	371
BmgT120I	GGNCC	1 cut(s)	289
BmiI	GGNNCC	2 cut(s)	176, 290
BmsI	GCATC	1 cut(s)	131
BoxI	GACNNNNGTC	1 cut(s)	219
BpiI	GAAGAC	1 cut(s)	624
BpuEI	CTTGAG	1 cut(s)	497
BsaBI	GATNNNNATC	1 cut(s)	664
BsaJI	CCNNGG	2 cut(s)	488, 764
BsaXI	ACNNNNNCTCC	2 cut(s)	756, 786
Bse1I	ACTGG	1 cut(s)	418
Bse8I	GATNNNNATC	1 cut(s)	664
BseDI	CCNNGG	2 cut(s)	488, 764
BseGI	GGATG	1 cut(s)	146
BseJI	GATNNNNATC	1 cut(s)	664
BseMII	CTCAG	4 cut(s)	95, 277, 331, 647
BseNI	ACTGG	1 cut(s)	418
BseRI	GAGGAG	2 cut(s)	389, 494
BseXI	GCAGC	2 cut(s)	131, 704
BsgI	GTGCAG	1 cut(s)	621
Bsh1285I	CGRYCG	1 cut(s)	799
BsiEI	CGRYCG	1 cut(s)	799
BsiHKCI	CYCGRG	1 cut(s)	371
BsiSI	CCGG	1 cut(s)	775
BslFI	GGGAC	1 cut(s)	587
BsmAI	GTCTC	2 cut(s)	94, 100
BsmFI	GGGAC	1 cut(s)	587
BsoBI	CYCGRG	1 cut(s)	371
Bsp143I	GATC	5 cut(s)	11, 313, 454, 604, 796
BspACI	CCGC	1 cut(s)	178
BspCNI	CTCAG	4 cut(s)	96, 276, 330, 648
BspLI	GGNNCC	2 cut(s)	176, 290
BspMI	ACCTGC	1 cut(s)	255
BspPI	GGATC	1 cut(s)	19
BsrI	ACTGG	1 cut(s)	418
BssECI	CCNNGG	2 cut(s)	488, 764
BssMI	GATC	5 cut(s)	11, 313, 454, 604, 796
BssT1I	CCWWGG	1 cut(s)	488
Bst4CI	ACNGT	2 cut(s)	395, 768
Bst6I	CTCTTC	1 cut(s)	92
BstDEI	CTNAG	4 cut(s)	104, 263, 317, 656
BstDSI	CCRYGG	1 cut(s)	764
BstF5I	GGATG	1 cut(s)	146
BstKTI	GATC	5 cut(s)	14, 316, 457, 607, 799
BstMAI	GTCTC	2 cut(s)	94, 100
BstMBI	GATC	5 cut(s)	11, 313, 454, 604, 796
BstMCI	CGRYCG	1 cut(s)	799
BstMWI	GCNNNNNNNGC	2 cut(s)	186, 741
BstPAI	GACNNNNGTC	1 cut(s)	219
BstSFI	CTRYAG	1 cut(s)	513
BstV1I	GCAGC	2 cut(s)	131, 704
BstV2I	GAAGAC	1 cut(s)	624
BstX2I	RGATCY	1 cut(s)	11
BstXI	CCANNNNNNTGG	1 cut(s)	425
BstYI	RGATCY	1 cut(s)	11
BtgI	CCRYGG	1 cut(s)	764
BtsCI	GGATG	1 cut(s)	146
BtsI	GCAGTG	1 cut(s)	609
BtsIMutI	CAGTG	1 cut(s)	609
BveI	ACCTGC	1 cut(s)	255
Cfr13I	GGNCC	1 cut(s)	289
CseI	GACGC	1 cut(s)	741
CviAII	CATG	1 cut(s)	577
CviJI	RGCY	8 cut(s)	133, 175, 189, 442, 484, 537, 705, 717
CviKI_1	RGCY	8 cut(s)	133, 175, 189, 442, 484, 537, 705, 717
DdeI	CTNAG	4 cut(s)	104, 263, 317, 656
DpnI	GATC	5 cut(s)	13, 315, 456, 606, 798
DpnII	GATC	5 cut(s)	11, 313, 454, 604, 796
DraI	TTTAAA	1 cut(s)	7
DrdI	GACNNNNNNGTC	1 cut(s)	586
DseDI	GACNNNNNNGTC	1 cut(s)	586
Eam1104I	CTCTTC	1 cut(s)	92
EarI	CTCTTC	1 cut(s)	92
Eco130I	CCWWGG	1 cut(s)	488
Eco32I	GATATC	1 cut(s)	791
Eco47I	GGWCC	1 cut(s)	289
Eco88I	CYCGRG	1 cut(s)	371
EcoO109I	RGGNCCY	1 cut(s)	289
EcoRV	GATATC	1 cut(s)	791
EcoT14I	CCWWGG	1 cut(s)	488
ErhI	CCWWGG	1 cut(s)	488
FaeI	CATG	1 cut(s)	580
FaiI	YATR	7 cut(s)	172, 206, 450, 501, 578, 617, 687
FalI	AAGNNNNNCTT	2 cut(s)	430, 462
FaqI	GGGAC	1 cut(s)	587
FatI	CATG	1 cut(s)	576
FblI	GTMKAC	1 cut(s)	590
Fnu4HI	GCNGC	2 cut(s)	145, 718
FokI	GGATG	1 cut(s)	153
Fsp4HI	GCNGC	2 cut(s)	145, 718
FspBI	CTAG	5 cut(s)	38, 186, 197, 224, 671
GluI	GCNGC	2 cut(s)	145, 718
HapII	CCGG	1 cut(s)	775
HgaI	GACGC	1 cut(s)	741
Hin1II	CATG	1 cut(s)	580
HinfI	GANTC	5 cut(s)	30, 200, 281, 307, 677
HpaII	CCGG	1 cut(s)	775
HphI	GGTGA	2 cut(s)	336, 407
Hpy166II	GTNNAC	2 cut(s)	415, 591
Hpy188I	TCNGA	2 cut(s)	16, 266
Hpy188III	TCNNGA	9 cut(s)	38, 113, 197, 224, 311, 371, 476, 794, 800
Hpy8I	GTNNAC	2 cut(s)	415, 591
Hpy99I	CGWCG	1 cut(s)	735
HpyCH4III	ACNGT	2 cut(s)	395, 768
HpyCH4IV	ACGT	1 cut(s)	270
HpyCH4V	TGCA	4 cut(s)	147, 542, 602, 720
HpyF10VI	GCNNNNNNNGC	2 cut(s)	186, 741
HpyF3I	CTNAG	4 cut(s)	104, 263, 317, 656
HpySE526I	ACGT	1 cut(s)	270
Hsp92II	CATG	1 cut(s)	580
Kzo9I	GATC	5 cut(s)	11, 313, 454, 604, 796
LmnI	GCTCC	2 cut(s)	180, 481
LpnPI	CCDG	7 cut(s)	166, 260, 270, 360, 431, 668, 788
Lsp1109I	GCAGC	2 cut(s)	131, 704
LweI	GCATC	1 cut(s)	131
MaeI	CTAG	5 cut(s)	38, 186, 197, 224, 671
MaeII	ACGT	1 cut(s)	270
MaeIII	GTNAC	1 cut(s)	517
MalI	GATC	5 cut(s)	13, 315, 456, 606, 798
MboI	GATC	5 cut(s)	11, 313, 454, 604, 796
MboII	GAAGA	5 cut(s)	109, 239, 290, 316, 624
MfeI	CAATTG	1 cut(s)	401
MflI	RGATCY	1 cut(s)	11
MluCI	AATT	8 cut(s)	21, 65, 252, 299, 401, 471, 554, 698
MlyI	GAGTC	2 cut(s)	24, 209
MseI	TTAA	7 cut(s)	6, 167, 335, 506, 531, 647, 701
MspA1I	CMGCKG	1 cut(s)	180
MspI	CCGG	1 cut(s)	775
MunI	CAATTG	1 cut(s)	401
MwoI	GCNNNNNNNGC	2 cut(s)	186, 741
NdeII	GATC	5 cut(s)	11, 313, 454, 604, 796
NlaIII	CATG	1 cut(s)	580
NlaIV	GGNNCC	2 cut(s)	176, 290
PaeR7I	CTCGAG	1 cut(s)	371
PfeI	GAWTC	3 cut(s)	281, 307, 677
PkrI	GCNGC	2 cut(s)	146, 719
Ple19I	CGATCG	1 cut(s)	799
PleI	GAGTC	2 cut(s)	24, 208
PpsI	GAGTC	2 cut(s)	24, 208
PpuMI	RGGWCCY	1 cut(s)	289
PshAI	GACNNNNGTC	1 cut(s)	219
Psp5II	RGGWCCY	1 cut(s)	289
PspN4I	GGNNCC	2 cut(s)	176, 290
PspPI	GGNCC	1 cut(s)	289
PspPPI	RGGWCCY	1 cut(s)	289
PsrI	GAACNNNNNNTAC	2 cut(s)	510, 542
PsuI	RGATCY	1 cut(s)	11
PvuI	CGATCG	1 cut(s)	799
SaqAI	TTAA	7 cut(s)	6, 167, 335, 506, 531, 647, 701
SatI	GCNGC	2 cut(s)	145, 718
Sau3AI	GATC	5 cut(s)	11, 313, 454, 604, 796
Sau96I	GGNCC	1 cut(s)	289
SchI	GAGTC	2 cut(s)	24, 209
SfaNI	GCATC	1 cut(s)	131
SfcI	CTRYAG	1 cut(s)	513
Sfr274I	CTCGAG	1 cut(s)	371
SinI	GGWCC	1 cut(s)	289
SlaI	CTCGAG	1 cut(s)	371
SmlI	CTYRAG	2 cut(s)	371, 476
SmoI	CTYRAG	2 cut(s)	371, 476
Sse9I	AATT	8 cut(s)	21, 65, 252, 299, 401, 471, 554, 698
SsiI	CCGC	1 cut(s)	178
SspI	AATATT	1 cut(s)	93
SspMI	CTAG	5 cut(s)	38, 186, 197, 224, 671
StyI	CCWWGG	1 cut(s)	488
TaaI	ACNGT	2 cut(s)	395, 768
TaiI	ACGT	1 cut(s)	273
TaqI	TCGA	3 cut(s)	114, 372, 795
TasI	AATT	8 cut(s)	21, 65, 252, 299, 401, 471, 554, 698
TfiI	GAWTC	3 cut(s)	281, 307, 677
Tru1I	TTAA	7 cut(s)	6, 167, 335, 506, 531, 647, 701
Tru9I	TTAA	7 cut(s)	6, 167, 335, 506, 531, 647, 701
TscAI	CASTG	1 cut(s)	616
TseI	GCWGC	2 cut(s)	144, 717
TspDTI	ATGAA	2 cut(s)	33, 412
TspGWI	ACGGA	1 cut(s)	476
TspRI	CASTG	1 cut(s)	616
VpaK11BI	GGWCC	1 cut(s)	289
XapI	RAATTY	3 cut(s)	21, 65, 471
XbaI	TCTAGA	3 cut(s)	37, 196, 223
XhoI	CTCGAG	1 cut(s)	371
XmiI	GTMKAC	1 cut(s)	590
XspI	CTAG	5 cut(s)	38, 186, 197, 224, 671

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.