Rmu_sc0000847.1_g000052

Rare lipoprotein A (RlpA)-like double-psi beta-barrel

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000847.1
N/A
Physical Location & Seq
Reverse (-)
226140 .. 229797
3658 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1461 bp
atgggaacccttcaagccatagttcttctctgcttggttttattgcatctgtgtagccacattctttcccaagatgaagattggaagactgctactgcaacatacaccaaagaaacagatggatctatcattactgaaggagcttgtggttatggggaccttcacaagattagctatgggaaatacagtgctgcgctaagtgggattttgttcaacagagggagtacttgcggtgcttgttatgagctgagatgtgttgaccacatcttatggtgtctgcaagggagtcccactattattctcactgctactgatttttgtccaccgaattttgggctctccgcagattatggtggctggtgcaatttccccaaggaacactttgagatgtcagaggcagcatttgctgaaattgcaaagaaaaaggctgatattgtgccagttcagtataggagggtgaggtgtgacagaattggagggctgcgattcactatgagtggaagttctcacttctatgaagtcttgattaccaatgtaggttcggacggggaagtgcttgctgtgaaggtgaagggttccagaaccgggtggataccgatggctagaaactggggacagaattggcaaagcaatgtcaatcttcaaggacagcctctttcttttgaggtaacggtcagtagcggaaaaacactcacatcttacaatgttgctccaccaaaatggcaatttggtcagacatttgaagggaaacagttctaccacattcttgcccaagatgaagattggaagactgctactgcaacatacaccaaagaaacagatggatctatcattactgaaggagcttgtggttatggggaccttcacaagattagctatgggaaatacagtgctgcgctaagtgggattttgttcaacagagggagtacttgcggtgcttgttatgagctgagatgtgttgaccacatcttatggtgtctgcaagggagtcccactattattctcactgctactgatttttgtccaccgaattttgggctctccgcagattatggtggctggtgcaatttccccaaggaacactttgagatgtcagaggcagcatttgctgaaattgcaaagaaaaaggctgatattgtgccagttcagtataggagggtgaggtgtgacagaattggagggctgcgattcactatgagtggaagttctcacttctatgaagtcttgattaccaatgtaggttcggacggggaagtgcttgctgtgaaggtgaagggttccagaaccgggtggataccgatggctagaaactggggacagaattggcaaagcaatgtcaatcttcaaggacagcctctttcttttgaggtaacggtcagtagcggaaaaacactcacatcttacaatgttgctccaccaaaatggcaatttggtcagacatttgaagggaaacagttctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005618 GO:0005623 GO:0006949 GO:0008150 GO:0009628 GO:0009653 GO:0009987 GO:0016020 GO:0030312 GO:0032502 GO:0044464 GO:0048646 GO:0048856 GO:0050896 GO:0071944 GO:0080167
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DPBB_1 Pollen_allerg_1

Protein Analysis

486

Amino Acids

53.66

Weight (kDa)

7.1

Isoelectric Point (pI)

41.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DPBB_1 PF03330 64 - 150 7e-17 Lytic transglycolase
Expansin_C PF01357 162 - 238 1e-27 Expansin C-terminal domain
DPBB_1 PF03330 298 - 384 7e-17 Lytic transglycolase
Expansin_C PF01357 396 - 472 1e-27 Expansin C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 6 cut(s) 231, 342, 681, 933, 1044, 1383
AclWI GGATC 2 cut(s) 130, 832
AcsI RAATTY 2 cut(s) 328, 1030
AcuI CTGAAG 2 cut(s) 156, 858
AfaI GTAC 2 cut(s) 226, 928
AfiI CCNNNNNNNGG 4 cut(s) 332, 585, 1034, 1287
AgsI TTSAA 7 cut(s) 14, 214, 644, 743, 916, 1346, 1445
AluBI AGCT 6 cut(s) 143, 174, 247, 845, 876, 949
AluI AGCT 6 cut(s) 143, 174, 247, 845, 876, 949
AlwI GGATC 2 cut(s) 130, 832
ApeKI GCWGC 6 cut(s) 191, 398, 481, 893, 1100, 1183
ApoI RAATTY 2 cut(s) 328, 1030
Asp700I GAANNNNTTC 2 cut(s) 752, 1454
AspLEI GCGC 2 cut(s) 196, 898
AspS9I GGNCC 2 cut(s) 157, 859
AsuC2I CCSGG 2 cut(s) 586, 1288
AsuHPI GGTGA 4 cut(s) 469, 580, 1171, 1282
AvaII GGWCC 2 cut(s) 157, 859
BanII GRGCYC 2 cut(s) 339, 1041
BbsI GAAGAC 2 cut(s) 92, 794
BbvI GCAGC 6 cut(s) 178, 410, 468, 880, 1112, 1170
BccI CCATC 4 cut(s) 113, 592, 815, 1294
BciVI GTATCC 2 cut(s) 585, 1287
BcnI CCSGG 2 cut(s) 586, 1288
BfaI CTAG 3 cut(s) 603, 1305, 1459
BfuI GTATCC 2 cut(s) 585, 1287
BisI GCNGC 6 cut(s) 192, 399, 482, 894, 1101, 1184
BlsI GCNGC 6 cut(s) 193, 400, 483, 895, 1102, 1185
BmcAI AGTACT 2 cut(s) 226, 928
Bme1390I CCNGG 2 cut(s) 586, 1288
Bme18I GGWCC 2 cut(s) 157, 859
BmgT120I GGNCC 2 cut(s) 157, 859
BmiI GGNNCC 5 cut(s) 7, 158, 577, 860, 1279
BmrFI CCNGG 2 cut(s) 586, 1288
BmrI ACTGGG 2 cut(s) 619, 1321
BmsI GCATC 1 cut(s) 55
BmuI ACTGGG 2 cut(s) 619, 1321
BpiI GAAGAC 2 cut(s) 92, 794
BpuMI CCSGG 2 cut(s) 586, 1288
BsaJI CCNNGG 2 cut(s) 372, 1074
Bsc4I CCNNNNNNNGG 4 cut(s) 332, 585, 1034, 1287
Bse1I ACTGG 4 cut(s) 440, 614, 1142, 1316
Bse3DI GCAATG 2 cut(s) 637, 1339
BseDI CCNNGG 2 cut(s) 372, 1074
BseLI CCNNNNNNNGG 4 cut(s) 332, 585, 1034, 1287
BseMI GCAATG 2 cut(s) 637, 1339
BseMII CTCAG 2 cut(s) 239, 941
BseNI ACTGG 4 cut(s) 440, 614, 1142, 1316
BseXI GCAGC 6 cut(s) 178, 410, 468, 880, 1112, 1170
BsiSI CCGG 2 cut(s) 585, 1287
BslFI GGGAC 6 cut(s) 170, 273, 627, 872, 975, 1329
BslI CCNNNNNNNGG 4 cut(s) 332, 585, 1034, 1287
BsmFI GGGAC 6 cut(s) 170, 273, 627, 872, 975, 1329
Bsp1286I GDGCHC 2 cut(s) 339, 1041
Bsp143I GATC 2 cut(s) 122, 824
BspACI CCGC 6 cut(s) 231, 342, 681, 933, 1044, 1383
BspCNI CTCAG 2 cut(s) 240, 942
BspLI GGNNCC 5 cut(s) 7, 158, 577, 860, 1279
BspPI GGATC 2 cut(s) 130, 832
BsrDI GCAATG 2 cut(s) 637, 1339
BsrI ACTGG 4 cut(s) 440, 614, 1142, 1316
BssECI CCNNGG 2 cut(s) 372, 1074
BssMI GATC 2 cut(s) 122, 824
BssT1I CCWWGG 2 cut(s) 372, 1074
Bst4CI ACNGT 6 cut(s) 188, 673, 753, 890, 1375, 1455
BstAPI GCANNNNNTGC 2 cut(s) 404, 1106
BstC8I GCNNGC 2 cut(s) 558, 1260
BstDEI CTNAG 4 cut(s) 197, 248, 899, 950
BstHHI GCGC 2 cut(s) 196, 898
BstKTI GATC 2 cut(s) 125, 827
BstMBI GATC 2 cut(s) 122, 824
BstMWI GCNNNNNNNGC 4 cut(s) 404, 413, 1106, 1115
BstSCI CCNGG 2 cut(s) 584, 1286
BstV1I GCAGC 6 cut(s) 178, 410, 468, 880, 1112, 1170
BstV2I GAAGAC 2 cut(s) 92, 794
BstX2I RGATCY 2 cut(s) 122, 824
BstXI CCANNNNNNTGG 2 cut(s) 720, 1422
BstYI RGATCY 2 cut(s) 122, 824
BsuI GTATCC 2 cut(s) 585, 1287
BtsI GCAGTG 2 cut(s) 303, 1005
BtsIMutI CAGTG 4 cut(s) 193, 303, 895, 1005
Cac8I GCNNGC 2 cut(s) 558, 1260
CfoI GCGC 2 cut(s) 196, 898
Cfr13I GGNCC 2 cut(s) 157, 859
Csp6I GTAC 2 cut(s) 225, 927
CviQI GTAC 2 cut(s) 225, 927
DdeI CTNAG 4 cut(s) 197, 248, 899, 950
DpnI GATC 2 cut(s) 124, 826
DpnII GATC 2 cut(s) 122, 824
Eco130I CCWWGG 2 cut(s) 372, 1074
Eco24I GRGCYC 2 cut(s) 339, 1041
Eco47I GGWCC 2 cut(s) 157, 859
Eco57I CTGAAG 2 cut(s) 156, 858
EcoO109I RGGNCCY 2 cut(s) 157, 859
EcoT14I CCWWGG 2 cut(s) 372, 1074
EcoT38I GRGCYC 2 cut(s) 339, 1041
ErhI CCWWGG 2 cut(s) 372, 1074
FalI AAGNNNNNCTT 4 cut(s) 365, 397, 1067, 1099
FaqI GGGAC 6 cut(s) 170, 273, 627, 872, 975, 1329
Fnu4HI GCNGC 6 cut(s) 192, 399, 482, 894, 1101, 1184
FriOI GRGCYC 2 cut(s) 339, 1041
Fsp4HI GCNGC 6 cut(s) 192, 399, 482, 894, 1101, 1184
FspBI CTAG 3 cut(s) 603, 1305, 1459
GlaI GCGC 2 cut(s) 195, 897
GluI GCNGC 6 cut(s) 192, 399, 482, 894, 1101, 1184
HapII CCGG 2 cut(s) 585, 1287
HhaI GCGC 2 cut(s) 196, 898
Hin6I GCGC 2 cut(s) 194, 896
HinP1I GCGC 2 cut(s) 194, 896
HincII GTYRAC 2 cut(s) 259, 961
HindII GTYRAC 2 cut(s) 259, 961
HinfI GANTC 4 cut(s) 286, 486, 988, 1188
HpaII CCGG 2 cut(s) 585, 1287
HphI GGTGA 4 cut(s) 469, 580, 1171, 1282
Hpy166II GTNNAC 4 cut(s) 259, 323, 961, 1025
Hpy188I TCNGA 6 cut(s) 394, 544, 735, 1096, 1246, 1437
Hpy188III TCNNGA 4 cut(s) 523, 579, 1225, 1281
Hpy8I GTNNAC 4 cut(s) 259, 323, 961, 1025
HpyCH4III ACNGT 6 cut(s) 188, 673, 753, 890, 1375, 1455
HpyCH4V TGCA 9 cut(s) 46, 98, 280, 363, 416, 800, 982, 1065, 1118
HpyF10VI GCNNNNNNNGC 4 cut(s) 404, 413, 1106, 1115
HpyF3I CTNAG 4 cut(s) 197, 248, 899, 950
HspAI GCGC 2 cut(s) 194, 896
Kzo9I GATC 2 cut(s) 122, 824
LmnI GCTCC 4 cut(s) 140, 715, 842, 1417
Lsp1109I GCAGC 6 cut(s) 178, 410, 468, 880, 1112, 1170
LweI GCATC 1 cut(s) 55
MaeI CTAG 3 cut(s) 603, 1305, 1459
MaeIII GTNAC 4 cut(s) 464, 667, 1166, 1369
MalI GATC 2 cut(s) 124, 826
MboI GATC 2 cut(s) 122, 824
MboII GAAGA 7 cut(s) 17, 89, 97, 632, 791, 799, 1334
MflI RGATCY 2 cut(s) 122, 824
MhlI GDGCHC 2 cut(s) 339, 1041
MlyI GAGTC 2 cut(s) 295, 997
MroXI GAANNNNTTC 2 cut(s) 752, 1454
MslI CAYNNNNRTG 4 cut(s) 513, 718, 1215, 1420
MspI CCGG 2 cut(s) 585, 1287
MspR9I CCNGG 2 cut(s) 586, 1288
MwoI GCNNNNNNNGC 4 cut(s) 404, 413, 1106, 1115
NciI CCSGG 2 cut(s) 586, 1288
NdeII GATC 2 cut(s) 122, 824
NlaIV GGNNCC 5 cut(s) 7, 158, 577, 860, 1279
NmuCI GTSAC 2 cut(s) 464, 1166
PdmI GAANNNNTTC 2 cut(s) 752, 1454
PfeI GAWTC 2 cut(s) 486, 1188
PkrI GCNGC 6 cut(s) 193, 400, 483, 895, 1102, 1185
PleI GAGTC 2 cut(s) 294, 996
PpsI GAGTC 2 cut(s) 294, 996
PpuMI RGGWCCY 2 cut(s) 157, 859
Psp5II RGGWCCY 2 cut(s) 157, 859
PspN4I GGNNCC 5 cut(s) 7, 158, 577, 860, 1279
PspPI GGNCC 2 cut(s) 157, 859
PspPPI RGGWCCY 2 cut(s) 157, 859
PsuI RGATCY 2 cut(s) 122, 824
RsaI GTAC 2 cut(s) 226, 928
RsaNI GTAC 2 cut(s) 225, 927
RseI CAYNNNNRTG 4 cut(s) 513, 718, 1215, 1420
SatI GCNGC 6 cut(s) 192, 399, 482, 894, 1101, 1184
Sau3AI GATC 2 cut(s) 122, 824
Sau96I GGNCC 2 cut(s) 157, 859
ScaI AGTACT 2 cut(s) 226, 928
SchI GAGTC 2 cut(s) 295, 997
ScrFI CCNGG 2 cut(s) 586, 1288
SduI GDGCHC 2 cut(s) 339, 1041
SfaNI GCATC 1 cut(s) 55
SinI GGWCC 2 cut(s) 157, 859
SmiMI CAYNNNNRTG 4 cut(s) 513, 718, 1215, 1420
SsiI CCGC 6 cut(s) 231, 342, 681, 933, 1044, 1383
SspMI CTAG 3 cut(s) 603, 1305, 1459
StyD4I CCNGG 2 cut(s) 584, 1286
StyI CCWWGG 2 cut(s) 372, 1074
TaaI ACNGT 6 cut(s) 188, 673, 753, 890, 1375, 1455
TatI WGTACW 2 cut(s) 224, 926
TfiI GAWTC 2 cut(s) 486, 1188
TscAI CASTG 4 cut(s) 193, 310, 895, 1012
TseFI GTSAC 2 cut(s) 464, 1166
TseI GCWGC 6 cut(s) 191, 398, 481, 893, 1100, 1183
Tsp45I GTSAC 2 cut(s) 464, 1166
TspDTI ATGAA 4 cut(s) 90, 531, 792, 1233
TspRI CASTG 4 cut(s) 193, 310, 895, 1012
VpaK11BI GGWCC 2 cut(s) 157, 859
XapI RAATTY 2 cut(s) 328, 1030
XmnI GAANNNNTTC 2 cut(s) 752, 1454
XspI CTAG 3 cut(s) 603, 1305, 1459
ZrmI AGTACT 2 cut(s) 226, 928
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.