Rmu_sc0000905.1_g000015

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000905.1
N/A
Physical Location & Seq
Forward (+)
47566 .. 49555
1990 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 969 bp
atgtctccatcacaattgaaatggtacacttggttttgtattctggtggggcatgtttgcatttttgccccgtcccttacttcagggcagtacagaagtacaggcaccatgtcagaagagtggatgaaaggtttggggtcacatataagtgatggctttgaaagcaggacctcgacttatgtggtaacaatgttatcatctccattaaatgaactagtatcttgtgaggacctggaaggtgttggatcattcaataccacatgcttgttaaactcaaacttctctttgaattctgatcttcacatacgtggtactggaaacctggagatactccctcatgtatcaattatttgtccgattgaaggctgcatgattacattcaacatgtctggaaatgttaaaattggtcaatatgcggctatagttgctggttctgtggtttttgcggctgccaatctgactatggggtataattcttctataaatacaacatctttgggtggactaccgccttctcaaactagtggaactccagtgggctatgatggaggtggtggagggcatggtggccgaggtgcttcttgcttgaaaaataatcagacgagcttttggggtggcgatgtttatacttggtcaaaattgtccgagccatggagttatgggagcaagggtggaggcacatctgctaaaattccatttggaggaaatggtggaggacgtgtcaagcttcaagtgaaggatatgttatatctaaatggatctgtaactgcagaaggaggggacggcggaacaactggtggaggaggatctggtggaagtatttttatacatgctgttaagttgaagggatacggtacaataagtgctgctggtggaagaggatggggtggaggtggtggtggaagaatatcacttgattgttacagcatacaagaagatgtaaaagtcactgtccatggttcgtactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

322

Amino Acids

33.21

Weight (kDa)

6.64

Isoelectric Point (pI)

38.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 104
AciI CCGC 4 cut(s) 416, 446, 509, 786
AclWI GGATC 3 cut(s) 253, 766, 814
AcoI YGGCCR 1 cut(s) 568
AcsI RAATTY 2 cut(s) 289, 690
AcuI CTGAAG 1 cut(s) 66
AfaI GTAC 6 cut(s) 26, 92, 100, 313, 856, 965
AfiI CCNNNNNNNGG 3 cut(s) 362, 651, 701
AflIII ACRYGT 2 cut(s) 384, 718
AgsI TTSAA 9 cut(s) 19, 161, 253, 289, 362, 382, 589, 731, 844
AhlI ACTAGT 2 cut(s) 214, 521
AjiI CACGTC 1 cut(s) 719
AjnI CCWGG 2 cut(s) 231, 321
AleI CACNNNNGTG 1 cut(s) 306
AluBI AGCT 2 cut(s) 606, 727
AluI AGCT 2 cut(s) 606, 727
Alw26I GTCTC 1 cut(s) 9
AlwI GGATC 3 cut(s) 253, 766, 814
AoxI GGCC 1 cut(s) 568
ApeKI GCWGC 3 cut(s) 366, 449, 866
ApoI RAATTY 2 cut(s) 289, 690
AspS9I GGNCC 2 cut(s) 168, 229
AvaII GGWCC 2 cut(s) 168, 229
BanI GGYRCC 1 cut(s) 104
BbvI GCAGC 3 cut(s) 353, 436, 853
BccI CCATC 4 cut(s) 16, 146, 539, 876
BceAI ACGGC 1 cut(s) 799
BciT130I CCWGG 2 cut(s) 233, 323
BciVI GTATCC 1 cut(s) 842
BcoDI GTCTC 1 cut(s) 9
BcuI ACTAGT 2 cut(s) 214, 521
BfaI CTAG 2 cut(s) 215, 522
BfmI CTRYAG 2 cut(s) 420, 768
BfuI GTATCC 1 cut(s) 842
BisI GCNGC 5 cut(s) 367, 417, 447, 450, 867
BlsI GCNGC 5 cut(s) 368, 418, 448, 451, 868
Bme1390I CCNGG 2 cut(s) 233, 323
Bme18I GGWCC 2 cut(s) 168, 229
BmgBI CACGTC 1 cut(s) 719
BmgT120I GGNCC 2 cut(s) 168, 229
BmiI GGNNCC 1 cut(s) 106
BmrFI CCNGG 2 cut(s) 233, 323
BpmI CTGGAG 2 cut(s) 344, 516
BsaAI YACGTR 1 cut(s) 308
BsaJI CCNNGG 3 cut(s) 571, 650, 955
BsaXI ACNNNNNCTCC 4 cut(s) 655, 685, 705, 735
Bsc4I CCNNNNNNNGG 3 cut(s) 362, 651, 701
Bse1I ACTGG 3 cut(s) 319, 533, 799
BseBI CCWGG 2 cut(s) 233, 323
BseDI CCNNGG 3 cut(s) 571, 650, 955
BseGI GGATG 2 cut(s) 129, 887
BseLI CCNNNNNNNGG 3 cut(s) 362, 651, 701
BseNI ACTGG 3 cut(s) 319, 533, 799
BseRI GAGGAG 1 cut(s) 816
BseXI GCAGC 3 cut(s) 353, 436, 853
BshFI GGCC 1 cut(s) 570
BshNI GGYRCC 1 cut(s) 104
BslFI GGGAC 2 cut(s) 58, 794
BslI CCNNNNNNNGG 3 cut(s) 362, 651, 701
BsmAI GTCTC 1 cut(s) 9
BsmFI GGGAC 2 cut(s) 58, 794
BsnI GGCC 1 cut(s) 570
Bsp143I GATC 4 cut(s) 245, 295, 758, 806
Bsp19I CCATGG 2 cut(s) 650, 955
BspACI CCGC 4 cut(s) 416, 446, 509, 786
BspANI GGCC 1 cut(s) 570
BspLI GGNNCC 1 cut(s) 106
BspMAI CTGCAG 1 cut(s) 772
BspPI GGATC 3 cut(s) 253, 766, 814
BspT107I GGYRCC 1 cut(s) 104
BsrI ACTGG 3 cut(s) 319, 533, 799
BssECI CCNNGG 3 cut(s) 571, 650, 955
BssMI GATC 4 cut(s) 245, 295, 758, 806
BssT1I CCWWGG 2 cut(s) 650, 955
Bst2UI CCWGG 2 cut(s) 233, 323
Bst4CI ACNGT 2 cut(s) 854, 952
Bst6I CTCTTC 2 cut(s) 111, 871
BstBAI YACGTR 1 cut(s) 308
BstDSI CCRYGG 2 cut(s) 650, 955
BstF5I GGATG 2 cut(s) 129, 887
BstKTI GATC 4 cut(s) 248, 298, 761, 809
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 4 cut(s) 245, 295, 758, 806
BstMWI GCNNNNNNNGC 2 cut(s) 162, 425
BstNI CCWGG 2 cut(s) 233, 323
BstNSI RCATGY 4 cut(s) 56, 264, 388, 833
BstSCI CCNGG 2 cut(s) 231, 321
BstSFI CTRYAG 2 cut(s) 420, 768
BstV1I GCAGC 3 cut(s) 353, 436, 853
BstX2I RGATCY 2 cut(s) 758, 806
BstYI RGATCY 2 cut(s) 758, 806
BsuI GTATCC 1 cut(s) 842
BsuRI GGCC 1 cut(s) 570
BtgI CCRYGG 2 cut(s) 650, 955
BtgZI GCGATG 1 cut(s) 633
BtrI CACGTC 1 cut(s) 719
BtsCI GGATG 2 cut(s) 129, 887
BtsIMutI CAGTG 2 cut(s) 540, 948
Cfr13I GGNCC 2 cut(s) 168, 229
Csp6I GTAC 6 cut(s) 25, 91, 99, 312, 855, 964
CviJI RGCY 9 cut(s) 156, 366, 419, 449, 540, 570, 606, 649, 727
CviKI_1 RGCY 9 cut(s) 156, 366, 419, 449, 540, 570, 606, 649, 727
CviQI GTAC 6 cut(s) 25, 91, 99, 312, 855, 964
DpnI GATC 4 cut(s) 247, 297, 760, 808
DpnII GATC 4 cut(s) 245, 295, 758, 806
EaeI YGGCCR 1 cut(s) 568
Eam1104I CTCTTC 2 cut(s) 111, 871
EarI CTCTTC 2 cut(s) 111, 871
EciI GGCGGA 1 cut(s) 801
Eco130I CCWWGG 2 cut(s) 650, 955
Eco47I GGWCC 2 cut(s) 168, 229
Eco57I CTGAAG 1 cut(s) 66
EcoO109I RGGNCCY 2 cut(s) 168, 229
EcoRI GAATTC 1 cut(s) 289
EcoRII CCWGG 2 cut(s) 231, 321
EcoT14I CCWWGG 2 cut(s) 650, 955
ErhI CCWWGG 2 cut(s) 650, 955
FaqI GGGAC 2 cut(s) 58, 794
Fnu4HI GCNGC 5 cut(s) 367, 417, 447, 450, 867
FokI GGATG 2 cut(s) 136, 894
Fsp4HI GCNGC 5 cut(s) 367, 417, 447, 450, 867
FspBI CTAG 2 cut(s) 215, 522
GluI GCNGC 5 cut(s) 367, 417, 447, 450, 867
GsuI CTGGAG 2 cut(s) 344, 516
HaeIII GGCC 1 cut(s) 570
HindIII AAGCTT 1 cut(s) 725
Hpy166II GTNNAC 2 cut(s) 27, 503
Hpy188I TCNGA 6 cut(s) 115, 295, 357, 459, 600, 646
Hpy188III TCNNGA 1 cut(s) 390
Hpy8I GTNNAC 2 cut(s) 27, 503
HpyAV CCTTC 6 cut(s) 230, 356, 522, 730, 767, 838
HpyCH4III ACNGT 2 cut(s) 854, 952
HpyCH4IV ACGT 2 cut(s) 307, 718
HpyCH4V TGCA 3 cut(s) 60, 369, 770
HpyF10VI GCNNNNNNNGC 2 cut(s) 162, 425
HpySE526I ACGT 2 cut(s) 307, 718
Kzo9I GATC 4 cut(s) 245, 295, 758, 806
LmnI GCTCC 1 cut(s) 663
Lsp1109I GCAGC 3 cut(s) 353, 436, 853
MaeI CTAG 2 cut(s) 215, 522
MaeII ACGT 2 cut(s) 307, 718
MaeIII GTNAC 5 cut(s) 138, 184, 763, 920, 946
MalI GATC 4 cut(s) 247, 297, 760, 808
MboI GATC 4 cut(s) 245, 295, 758, 806
MboII GAAGA 6 cut(s) 128, 290, 468, 888, 915, 947
MfeI CAATTG 1 cut(s) 14
MflI RGATCY 2 cut(s) 758, 806
MluCI AATT 7 cut(s) 14, 289, 345, 402, 472, 638, 690
MmeI TCCRAC 1 cut(s) 223
MseI TTAA 4 cut(s) 206, 269, 399, 837
MslI CAYNNNNRTG 2 cut(s) 147, 306
MspR9I CCNGG 2 cut(s) 233, 323
MunI CAATTG 1 cut(s) 14
MvaI CCWGG 2 cut(s) 233, 323
MwoI GCNNNNNNNGC 2 cut(s) 162, 425
NcoI CCATGG 2 cut(s) 650, 955
NdeII GATC 4 cut(s) 245, 295, 758, 806
NlaIV GGNNCC 1 cut(s) 106
NmeAIII GCCGAG 1 cut(s) 596
NmuCI GTSAC 2 cut(s) 138, 946
NspI RCATGY 4 cut(s) 56, 264, 388, 833
OliI CACNNNNGTG 1 cut(s) 306
PciI ACATGT 1 cut(s) 384
PkrI GCNGC 5 cut(s) 368, 418, 448, 451, 868
Ppu21I YACGTR 1 cut(s) 308
PpuMI RGGWCCY 2 cut(s) 168, 229
PscI ACATGT 1 cut(s) 384
Psp5II RGGWCCY 2 cut(s) 168, 229
Psp6I CCWGG 2 cut(s) 231, 321
PspGI CCWGG 2 cut(s) 231, 321
PspN4I GGNNCC 1 cut(s) 106
PspPI GGNCC 2 cut(s) 168, 229
PspPPI RGGWCCY 2 cut(s) 168, 229
PstI CTGCAG 1 cut(s) 772
PsuI RGATCY 2 cut(s) 758, 806
RsaI GTAC 6 cut(s) 26, 92, 100, 313, 856, 965
RsaNI GTAC 6 cut(s) 25, 91, 99, 312, 855, 964
RseI CAYNNNNRTG 2 cut(s) 147, 306
SaqAI TTAA 4 cut(s) 206, 269, 399, 837
SatI GCNGC 5 cut(s) 367, 417, 447, 450, 867
Sau3AI GATC 4 cut(s) 245, 295, 758, 806
Sau96I GGNCC 2 cut(s) 168, 229
ScrFI CCNGG 2 cut(s) 233, 323
SfcI CTRYAG 2 cut(s) 420, 768
SinI GGWCC 2 cut(s) 168, 229
SmiMI CAYNNNNRTG 2 cut(s) 147, 306
SpeI ACTAGT 2 cut(s) 214, 521
Sse9I AATT 7 cut(s) 14, 289, 345, 402, 472, 638, 690
SsiI CCGC 4 cut(s) 416, 446, 509, 786
SspMI CTAG 2 cut(s) 215, 522
StyD4I CCNGG 2 cut(s) 231, 321
StyI CCWWGG 2 cut(s) 650, 955
TaaI ACNGT 2 cut(s) 854, 952
TaiI ACGT 2 cut(s) 310, 721
TaqI TCGA 1 cut(s) 173
TasI AATT 7 cut(s) 14, 289, 345, 402, 472, 638, 690
TatI WGTACW 2 cut(s) 90, 98
TauI GCSGC 2 cut(s) 419, 449
Tru1I TTAA 4 cut(s) 206, 269, 399, 837
Tru9I TTAA 4 cut(s) 206, 269, 399, 837
TscAI CASTG 2 cut(s) 540, 955
TseFI GTSAC 2 cut(s) 138, 946
TseI GCWGC 3 cut(s) 366, 449, 866
Tsp45I GTSAC 2 cut(s) 138, 946
TspDTI ATGAA 2 cut(s) 140, 225
TspRI CASTG 2 cut(s) 540, 955
VpaK11BI GGWCC 2 cut(s) 168, 229
XapI RAATTY 2 cut(s) 289, 690
XceI RCATGY 4 cut(s) 56, 264, 388, 833
XcmI CCANNNNNNNNNTGG 1 cut(s) 460
XspI CTAG 2 cut(s) 215, 522
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.