Rmu_sc0000942.1_g000011

Ripening-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000942.1
N/A
Physical Location & Seq
Reverse (-)
55777 .. 58318
2542 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 498 bp
atggtgatcgatcgggataggctaggagcggctgggttgcagggaggcgaggcaaagtgcggctgggctgtagggaggcgagctggacagggctggaacggactgggctgcagggggcaattgggcggtggggctgcagggaggctggagagcttgcggctagggctgcaggtgagctgcagcagggaggttggaggctgcggcaggaggcaagctctacaccacttacaagtgctcgcctctgggtccaagagtacaaaagcaaccttgaagatcaacaggttcgagaaaggtggtgatagtggtggaccgtcggattgtgataataaattccactcggataacaccgcgatcgtggcattgtccaccggcttgttcaacaataggaagaggtgttcacactacattaccatacatggtaatggaaggactgtgaaagccaaggttgttgatgagtgtaactccacaatggattgtgatcctgttcatcattactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

165

Amino Acids

17.46

Weight (kDa)

9.41

Isoelectric Point (pI)

40.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
KWL1 PF24300 80 - 164 7.9e-24 Kiwellin-1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 160
Acc36I ACCTGC 1 cut(s) 160
AccBSI CCGCTC 1 cut(s) 29
AccII CGCG 1 cut(s) 350
AciI CCGC 6 cut(s) 29, 60, 126, 157, 201, 348
AclWI GGATC 1 cut(s) 473
AcsI RAATTY 1 cut(s) 329
AfaI GTAC 1 cut(s) 256
AgsI TTSAA 2 cut(s) 271, 379
AloI GAACNNNNNNTCC 2 cut(s) 379, 411
AluBI AGCT 4 cut(s) 83, 153, 177, 215
AluI AGCT 4 cut(s) 83, 153, 177, 215
Alw21I GWGCWC 1 cut(s) 237
AlwI GGATC 1 cut(s) 473
ApeKI GCWGC 6 cut(s) 108, 134, 166, 177, 180, 198
ApoI RAATTY 1 cut(s) 329
AspS9I GGNCC 2 cut(s) 246, 308
AsuHPI GGTGA 3 cut(s) 16, 184, 308
AvaII GGWCC 2 cut(s) 246, 308
Bbv12I GWGCWC 1 cut(s) 237
BbvI GCAGC 6 cut(s) 95, 121, 153, 164, 185, 192
BfaI CTAG 3 cut(s) 23, 161, 496
BfmI CTRYAG 5 cut(s) 69, 109, 135, 167, 178
BfuAI ACCTGC 1 cut(s) 160
Bme18I GGWCC 2 cut(s) 246, 308
BmgT120I GGNCC 2 cut(s) 246, 308
BmiI GGNNCC 1 cut(s) 247
BmrI ACTGGG 1 cut(s) 113
BmuI ACTGGG 1 cut(s) 113
BplI GAGNNNNNCTC 4 cut(s) 199, 231, 446, 478
BpmI CTGGAG 1 cut(s) 167
Bsa29I ATCGAT 1 cut(s) 9
BsaBI GATNNNNATC 1 cut(s) 477
BsaJI CCNNGG 1 cut(s) 441
Bse118I RCCGGY 1 cut(s) 368
Bse1I ACTGG 1 cut(s) 108
Bse8I GATNNNNATC 1 cut(s) 477
BseCI ATCGAT 1 cut(s) 9
BseDI CCNNGG 1 cut(s) 441
BseJI GATNNNNATC 1 cut(s) 477
BseNI ACTGG 1 cut(s) 108
BseXI GCAGC 6 cut(s) 95, 121, 153, 164, 185, 192
BseYI CCCAGC 2 cut(s) 32, 63
Bsh1236I CGCG 1 cut(s) 350
Bsh1285I CGRYCG 2 cut(s) 13, 354
BshVI ATCGAT 1 cut(s) 9
BsiEI CGRYCG 2 cut(s) 13, 354
BsiHKAI GWGCWC 1 cut(s) 237
BsiSI CCGG 1 cut(s) 369
Bsp1286I GDGCHC 1 cut(s) 237
Bsp143I GATC 5 cut(s) 6, 10, 273, 351, 478
BspACI CCGC 6 cut(s) 29, 60, 126, 157, 201, 348
BspDI ATCGAT 1 cut(s) 9
BspFNI CGCG 1 cut(s) 350
BspLI GGNNCC 1 cut(s) 247
BspMAI CTGCAG 4 cut(s) 113, 139, 171, 182
BspMI ACCTGC 1 cut(s) 160
BspPI GGATC 1 cut(s) 473
BsrBI CCGCTC 1 cut(s) 29
BsrFI RCCGGY 1 cut(s) 368
BsrI ACTGG 1 cut(s) 108
BssAI RCCGGY 1 cut(s) 368
BssECI CCNNGG 1 cut(s) 441
BssMI GATC 5 cut(s) 6, 10, 273, 351, 478
BssT1I CCWWGG 1 cut(s) 441
Bst4CI ACNGT 2 cut(s) 312, 433
Bst6I CTCTTC 1 cut(s) 383
BstC8I GCNNGC 4 cut(s) 81, 155, 213, 237
BstFNI CGCG 1 cut(s) 350
BstKTI GATC 5 cut(s) 9, 13, 276, 354, 481
BstMBI GATC 5 cut(s) 6, 10, 273, 351, 478
BstMCI CGRYCG 2 cut(s) 13, 354
BstMWI GCNNNNNNNGC 3 cut(s) 163, 166, 356
BstSFI CTRYAG 5 cut(s) 69, 109, 135, 167, 178
BstUI CGCG 1 cut(s) 350
BstV1I GCAGC 6 cut(s) 95, 121, 153, 164, 185, 192
Bsu15I ATCGAT 1 cut(s) 9
BsuTUI ATCGAT 1 cut(s) 9
BveI ACCTGC 1 cut(s) 160
Cac8I GCNNGC 4 cut(s) 81, 155, 213, 237
Cfr10I RCCGGY 1 cut(s) 368
Cfr13I GGNCC 2 cut(s) 246, 308
ClaI ATCGAT 1 cut(s) 9
Csp6I GTAC 1 cut(s) 255
CviAII CATG 1 cut(s) 416
CviQI GTAC 1 cut(s) 255
DpnI GATC 5 cut(s) 8, 12, 275, 353, 480
DpnII GATC 5 cut(s) 6, 10, 273, 351, 478
Eam1104I CTCTTC 1 cut(s) 383
EarI CTCTTC 1 cut(s) 383
Eco130I CCWWGG 1 cut(s) 441
Eco47I GGWCC 2 cut(s) 246, 308
EcoT14I CCWWGG 1 cut(s) 441
ErhI CCWWGG 1 cut(s) 441
FaeI CATG 1 cut(s) 419
FaiI YATR 2 cut(s) 413, 417
FatI CATG 1 cut(s) 415
FspBI CTAG 3 cut(s) 23, 161, 496
GsaI CCCAGC 2 cut(s) 36, 67
GsuI CTGGAG 1 cut(s) 167
HapII CCGG 1 cut(s) 369
Hin1II CATG 1 cut(s) 419
HpaII CCGG 1 cut(s) 369
HphI GGTGA 3 cut(s) 16, 184, 308
Hpy166II GTNNAC 3 cut(s) 308, 366, 398
Hpy188I TCNGA 2 cut(s) 316, 340
Hpy188III TCNNGA 2 cut(s) 14, 286
Hpy8I GTNNAC 3 cut(s) 308, 366, 398
Hpy99I CGWCG 1 cut(s) 316
HpyAV CCTTC 1 cut(s) 420
HpyCH4III ACNGT 2 cut(s) 312, 433
HpyCH4V TGCA 5 cut(s) 40, 111, 137, 169, 180
HpyF10VI GCNNNNNNNGC 3 cut(s) 163, 166, 356
Hsp92II CATG 1 cut(s) 419
Kzo9I GATC 5 cut(s) 6, 10, 273, 351, 478
LmnI GCTCC 1 cut(s) 26
Lsp1109I GCAGC 6 cut(s) 95, 121, 153, 164, 185, 192
MaeI CTAG 3 cut(s) 23, 161, 496
MaeIII GTNAC 1 cut(s) 458
MalI GATC 5 cut(s) 8, 12, 275, 353, 480
MbiI CCGCTC 1 cut(s) 29
MboI GATC 5 cut(s) 6, 10, 273, 351, 478
MboII GAAGA 2 cut(s) 283, 400
MfeI CAATTG 1 cut(s) 119
MhlI GDGCHC 1 cut(s) 237
MluCI AATT 2 cut(s) 119, 329
MmeI TCCRAC 2 cut(s) 172, 294
MnlI CCTC 9 cut(s) 38, 43, 69, 135, 181, 188, 201, 250, 384
MslI CAYNNNNRTG 1 cut(s) 420
MspI CCGG 1 cut(s) 369
MunI CAATTG 1 cut(s) 119
MvnI CGCG 1 cut(s) 350
MwoI GCNNNNNNNGC 3 cut(s) 163, 166, 356
NdeII GATC 5 cut(s) 6, 10, 273, 351, 478
NlaIII CATG 1 cut(s) 419
NlaIV GGNNCC 1 cut(s) 247
PaqCI CACCTGC 1 cut(s) 160
Ple19I CGATCG 2 cut(s) 13, 354
PspFI CCCAGC 2 cut(s) 32, 63
PspN4I GGNNCC 1 cut(s) 247
PspPI GGNCC 2 cut(s) 246, 308
PstI CTGCAG 4 cut(s) 113, 139, 171, 182
PvuI CGATCG 2 cut(s) 13, 354
RsaI GTAC 1 cut(s) 256
RsaNI GTAC 1 cut(s) 255
RseI CAYNNNNRTG 1 cut(s) 420
Sau3AI GATC 5 cut(s) 6, 10, 273, 351, 478
Sau96I GGNCC 2 cut(s) 246, 308
SduI GDGCHC 1 cut(s) 237
SfcI CTRYAG 5 cut(s) 69, 109, 135, 167, 178
SinI GGWCC 2 cut(s) 246, 308
SmiMI CAYNNNNRTG 1 cut(s) 420
Sse9I AATT 2 cut(s) 119, 329
SsiI CCGC 6 cut(s) 29, 60, 126, 157, 201, 348
SspMI CTAG 3 cut(s) 23, 161, 496
StyI CCWWGG 1 cut(s) 441
TaaI ACNGT 2 cut(s) 312, 433
TaqI TCGA 2 cut(s) 9, 285
TasI AATT 2 cut(s) 119, 329
TatI WGTACW 1 cut(s) 254
TauI GCSGC 4 cut(s) 32, 63, 160, 204
TseI GCWGC 6 cut(s) 108, 134, 166, 177, 180, 198
TspDTI ATGAA 1 cut(s) 476
TspGWI ACGGA 1 cut(s) 114
VpaK11BI GGWCC 2 cut(s) 246, 308
XapI RAATTY 1 cut(s) 329
XspI CTAG 3 cut(s) 23, 161, 496
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.