Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000977.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 780

Gene Structure 780 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 518 bp

ctcctgagtctcatcccaaggcccctcgaagtccaaggatgactacctatcagaagcaagggacacaaattcctgttctgcagattccatcaacacctgaaccaccaagatttgctacaaatgaggtacagcttgttatggaaagcaagggcagtctttcaacgggttttgtaacacctaatttgacaagtagaacaactggaaaaggatcacagataaggagatccttgcggaccattggaaaactgattaatggctctgagaagaggaaccagcaacctatgatggaaacacattcaactactaaatgtgcaggcaatttgaatgatgagaaatcacagattactagtagtgcaagaactctgaggcggcaatcattaacaggcattccaacatcaggatctgctcgacgatcctctcttggagggaagccagaagaaactagtgtaaatgacaagagagccaaaacacctccacctgtctgctcgtcaacgaaaaataacaagcggtggctttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003774 GO:0003777 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005856 GO:0005871 GO:0005875 GO:0006928 GO:0007017 GO:0007018 GO:0008150 GO:0009987 GO:0015630 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0032991 GO:0043226 GO:0043228 GO:0043229 GO:0043232 GO:0044422 GO:0044424 GO:0044430 GO:0044446 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

CH Kinesin Microtub_bd

Protein Analysis

171

Amino Acids

18.71

Weight (kDa)

10.99

Isoelectric Point (pI)

65.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	3 cut(s)	231, 369, 507
AclWI	GGATC	4 cut(s)	216, 218, 407, 408
AcsI	RAATTY	1 cut(s)	68
AfaI	GTAC	1 cut(s)	128
AfiI	CCNNNNNNNGG	1 cut(s)	397
AgsI	TTSAA	3 cut(s)	161, 299, 324
AhlI	ACTAGT	2 cut(s)	346, 442
AluBI	AGCT	1 cut(s)	132
AluI	AGCT	1 cut(s)	132
Alw26I	GTCTC	1 cut(s)	14
AlwI	GGATC	4 cut(s)	216, 218, 407, 408
AlwNI	CAGNNNCTG	1 cut(s)	403
AoxI	GGCC	1 cut(s)	20
ApoI	RAATTY	1 cut(s)	68
AseI	ATTAAT	1 cut(s)	251
AspS9I	GGNCC	2 cut(s)	21, 233
AvaII	GGWCC	1 cut(s)	233
BccI	CCATC	2 cut(s)	96, 279
BcoDI	GTCTC	1 cut(s)	14
BcuI	ACTAGT	2 cut(s)	346, 442
BfaI	CTAG	2 cut(s)	347, 443
BfmI	CTRYAG	1 cut(s)	79
BisI	GCNGC	1 cut(s)	370
BlsI	GCNGC	1 cut(s)	371
Bme18I	GGWCC	1 cut(s)	233
BmgT120I	GGNCC	2 cut(s)	21, 233
BmiI	GGNNCC	2 cut(s)	23, 271
BsaJI	CCNNGG	2 cut(s)	17, 34
Bsc4I	CCNNNNNNNGG	1 cut(s)	397
Bse1I	ACTGG	1 cut(s)	204
BseDI	CCNNGG	2 cut(s)	17, 34
BseGI	GGATG	2 cut(s)	12, 44
BseLI	CCNNNNNNNGG	1 cut(s)	397
BseMII	CTCAG	2 cut(s)	251, 355
BseNI	ACTGG	1 cut(s)	204
BsgI	GTGCAG	1 cut(s)	332
BshFI	GGCC	1 cut(s)	22
BslFI	GGGAC	1 cut(s)	75
BslI	CCNNNNNNNGG	1 cut(s)	397
BsmAI	GTCTC	1 cut(s)	14
BsmFI	GGGAC	1 cut(s)	75
BsmI	GAATGC	1 cut(s)	386
BsnI	GGCC	1 cut(s)	22
Bsp143I	GATC	4 cut(s)	208, 223, 400, 412
BspACI	CCGC	3 cut(s)	231, 369, 507
BspANI	GGCC	1 cut(s)	22
BspCNI	CTCAG	2 cut(s)	252, 356
BspLI	GGNNCC	2 cut(s)	23, 271
BspMAI	CTGCAG	1 cut(s)	83
BspPI	GGATC	4 cut(s)	216, 218, 407, 408
BsrI	ACTGG	1 cut(s)	204
BssECI	CCNNGG	2 cut(s)	17, 34
BssMI	GATC	4 cut(s)	208, 223, 400, 412
BssT1I	CCWWGG	2 cut(s)	17, 34
Bst6I	CTCTTC	1 cut(s)	259
BstC8I	GCNNGC	1 cut(s)	315
BstDEI	CTNAG	3 cut(s)	5, 260, 364
BstF5I	GGATG	2 cut(s)	12, 44
BstKTI	GATC	4 cut(s)	211, 226, 403, 415
BstMAI	GTCTC	1 cut(s)	14
BstMBI	GATC	4 cut(s)	208, 223, 400, 412
BstSFI	CTRYAG	1 cut(s)	79
BstX2I	RGATCY	2 cut(s)	223, 400
BstYI	RGATCY	2 cut(s)	223, 400
BsuRI	GGCC	1 cut(s)	22
BtsCI	GGATG	2 cut(s)	12, 44
Cac8I	GCNNGC	1 cut(s)	315
CaiI	CAGNNNCTG	1 cut(s)	403
Cfr13I	GGNCC	2 cut(s)	21, 233
Csp6I	GTAC	1 cut(s)	127
CviJI	RGCY	6 cut(s)	22, 132, 257, 432, 463, 513
CviKI_1	RGCY	6 cut(s)	22, 132, 257, 432, 463, 513
CviQI	GTAC	1 cut(s)	127
DdeI	CTNAG	3 cut(s)	5, 260, 364
DpnI	GATC	4 cut(s)	210, 225, 402, 414
DpnII	GATC	4 cut(s)	208, 223, 400, 412
Eam1104I	CTCTTC	1 cut(s)	259
EarI	CTCTTC	1 cut(s)	259
Eco130I	CCWWGG	2 cut(s)	17, 34
Eco47I	GGWCC	1 cut(s)	233
EcoO109I	RGGNCCY	1 cut(s)	21
EcoT14I	CCWWGG	2 cut(s)	17, 34
ErhI	CCWWGG	2 cut(s)	17, 34
FaiI	YATR	2 cut(s)	139, 283
FaqI	GGGAC	1 cut(s)	75
Fnu4HI	GCNGC	1 cut(s)	370
FokI	GGATG	1 cut(s)	51
Fsp4HI	GCNGC	1 cut(s)	370
FspBI	CTAG	2 cut(s)	347, 443
GluI	GCNGC	1 cut(s)	370
HaeIII	GGCC	1 cut(s)	22
HincII	GTYRAC	1 cut(s)	491
HindII	GTYRAC	1 cut(s)	491
HinfI	GANTC	2 cut(s)	7, 84
Hpy166II	GTNNAC	1 cut(s)	491
Hpy188I	TCNGA	3 cut(s)	53, 261, 365
Hpy188III	TCNNGA	2 cut(s)	4, 398
Hpy8I	GTNNAC	1 cut(s)	491
Hpy99I	CGWCG	1 cut(s)	413
HpyCH4V	TGCA	3 cut(s)	81, 313, 355
HpyF3I	CTNAG	3 cut(s)	5, 260, 364
Kzo9I	GATC	4 cut(s)	208, 223, 400, 412
MaeI	CTAG	2 cut(s)	347, 443
MaeIII	GTNAC	1 cut(s)	171
MalI	GATC	4 cut(s)	210, 225, 402, 414
MboI	GATC	4 cut(s)	208, 223, 400, 412
MboII	GAAGA	2 cut(s)	276, 448
MflI	RGATCY	2 cut(s)	223, 400
MluCI	AATT	3 cut(s)	68, 180, 318
MlyI	GAGTC	1 cut(s)	16
MmeI	TCCRAC	1 cut(s)	415
MnlI	CCTC	7 cut(s)	35, 117, 260, 359, 418, 426, 482
MseI	TTAA	2 cut(s)	251, 379
Mva1269I	GAATGC	1 cut(s)	386
NdeII	GATC	4 cut(s)	208, 223, 400, 412
NlaIV	GGNNCC	2 cut(s)	23, 271
PctI	GAATGC	1 cut(s)	386
PfeI	GAWTC	1 cut(s)	84
PkrI	GCNGC	1 cut(s)	371
PleI	GAGTC	1 cut(s)	15
PpsI	GAGTC	1 cut(s)	15
PshBI	ATTAAT	1 cut(s)	251
PspN4I	GGNNCC	2 cut(s)	23, 271
PspPI	GGNCC	2 cut(s)	21, 233
PstI	CTGCAG	1 cut(s)	83
PstNI	CAGNNNCTG	1 cut(s)	403
PsuI	RGATCY	2 cut(s)	223, 400
RsaI	GTAC	1 cut(s)	128
RsaNI	GTAC	1 cut(s)	127
SaqAI	TTAA	2 cut(s)	251, 379
SatI	GCNGC	1 cut(s)	370
Sau3AI	GATC	4 cut(s)	208, 223, 400, 412
Sau96I	GGNCC	2 cut(s)	21, 233
SchI	GAGTC	1 cut(s)	16
SetI	ASST	8 cut(s)	49, 99, 128, 134, 180, 282, 474, 480
SfcI	CTRYAG	1 cut(s)	79
SinI	GGWCC	1 cut(s)	233
SpeI	ACTAGT	2 cut(s)	346, 442
Sse9I	AATT	3 cut(s)	68, 180, 318
SsiI	CCGC	3 cut(s)	231, 369, 507
SspMI	CTAG	2 cut(s)	347, 443
StyI	CCWWGG	2 cut(s)	17, 34
TaqI	TCGA	2 cut(s)	27, 408
TasI	AATT	3 cut(s)	68, 180, 318
TauI	GCSGC	1 cut(s)	372
TfiI	GAWTC	1 cut(s)	84
Tru1I	TTAA	2 cut(s)	251, 379
Tru9I	TTAA	2 cut(s)	251, 379
VpaK11BI	GGWCC	1 cut(s)	233
VspI	ATTAAT	1 cut(s)	251
XapI	RAATTY	1 cut(s)	68
XspI	CTAG	2 cut(s)	347, 443

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.