Rmu_sc0000979.1_g000016

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000979.1
N/A
Physical Location & Seq
Forward (+)
86580 .. 87104
525 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 525 bp
atgtttctgaggcgacatattgatcctaggctatgctgggagtaccttcagttgaagacacccaaagaattatgggttgcccttaagggacattttgggaacattcatgacactttgcttccagaactggccgttcagtggaatggaatccgattgcttgactataaaaaggtcaatgacttcaacaagaacatgttgcgcttaaaggtacgtctcaatttctgtggaaggaaaatcacagaagatgatatgatctacaagactcttaccacctttcctacttcagcatttatactaacgaaccagtataagttggagtatgacaacaaaagaatcacaaccttcaataagttgataagcctactgcaagtggctgaaagacataatgaggttctcttgaacaacaatgtcaggcccactaggacaaagaaaattcctctctttcttcctgagcgtctttctgtaaatatggagaaacccaatagttttccattgcaattcttagtagcttgtaacaaacaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 zf-CCHC

Protein Analysis

174

Amino Acids

20.72

Weight (kDa)

9.82

Isoelectric Point (pI)

45.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 17
AcoI YGGCCR 1 cut(s) 129
AcsI RAATTY 1 cut(s) 432
AcuI CTGAAG 2 cut(s) 32, 267
AfaI GTAC 2 cut(s) 44, 210
AfiI CCNNNNNNNGG 1 cut(s) 138
AflII CTTAAG 1 cut(s) 83
AflIII ACRYGT 1 cut(s) 192
AgsI TTSAA 4 cut(s) 55, 184, 346, 400
AluBI AGCT 1 cut(s) 509
AluI AGCT 1 cut(s) 509
Alw26I GTCTC 1 cut(s) 218
AlwI GGATC 1 cut(s) 17
AoxI GGCC 2 cut(s) 129, 413
ApoI RAATTY 1 cut(s) 432
AspA2I CCTAGG 1 cut(s) 26
AspLEI GCGC 1 cut(s) 201
AspS9I GGNCC 1 cut(s) 414
AvrII CCTAGG 1 cut(s) 26
BbsI GAAGAC 1 cut(s) 62
BceAI ACGGC 1 cut(s) 116
BcoDI GTCTC 1 cut(s) 218
BfaI CTAG 2 cut(s) 27, 420
BfrI CTTAAG 1 cut(s) 83
BlnI CCTAGG 1 cut(s) 26
BmgT120I GGNCC 1 cut(s) 414
BpiI GAAGAC 1 cut(s) 62
Bpu10I CCTNAGC 1 cut(s) 450
BsaJI CCNNGG 1 cut(s) 26
Bsc4I CCNNNNNNNGG 1 cut(s) 138
Bse1I ACTGG 2 cut(s) 132, 304
Bse3DI GCAATG 1 cut(s) 491
BseDI CCNNGG 1 cut(s) 26
BseLI CCNNNNNNNGG 1 cut(s) 138
BseMI GCAATG 1 cut(s) 491
BseMII CTCAG 1 cut(s) 441
BseNI ACTGG 2 cut(s) 132, 304
BseYI CCCAGC 1 cut(s) 36
BshFI GGCC 2 cut(s) 131, 415
BslFI GGGAC 1 cut(s) 102
BslI CCNNNNNNNGG 1 cut(s) 138
BsmAI GTCTC 1 cut(s) 218
BsmBI CGTCTC 1 cut(s) 218
BsmFI GGGAC 1 cut(s) 102
BsnI GGCC 2 cut(s) 131, 415
Bsp143I GATC 2 cut(s) 22, 252
BspANI GGCC 2 cut(s) 131, 415
BspCNI CTCAG 1 cut(s) 442
BspHI TCATGA 1 cut(s) 106
BspPI GGATC 1 cut(s) 17
BspTI CTTAAG 1 cut(s) 83
BsrDI GCAATG 1 cut(s) 491
BsrI ACTGG 2 cut(s) 132, 304
BssECI CCNNGG 1 cut(s) 26
BssMI GATC 2 cut(s) 22, 252
BssT1I CCWWGG 1 cut(s) 26
BstAFI CTTAAG 1 cut(s) 83
BstDEI CTNAG 3 cut(s) 8, 450, 502
BstHHI GCGC 1 cut(s) 201
BstKTI GATC 2 cut(s) 25, 255
BstMAI GTCTC 1 cut(s) 218
BstMBI GATC 2 cut(s) 22, 252
BstNSI RCATGY 1 cut(s) 196
BstV2I GAAGAC 1 cut(s) 62
BsuRI GGCC 2 cut(s) 131, 415
BtsIMutI CAGTG 1 cut(s) 143
CciI TCATGA 1 cut(s) 106
CfoI GCGC 1 cut(s) 201
Cfr13I GGNCC 1 cut(s) 414
CseI GACGC 1 cut(s) 443
Csp6I GTAC 2 cut(s) 43, 209
CspCI CAANNNNNGTGG 2 cut(s) 205, 240
CviAII CATG 2 cut(s) 107, 193
CviJI RGCY 6 cut(s) 31, 131, 360, 374, 415, 509
CviKI_1 RGCY 6 cut(s) 31, 131, 360, 374, 415, 509
CviQI GTAC 2 cut(s) 43, 209
DdeI CTNAG 3 cut(s) 8, 450, 502
DpnI GATC 2 cut(s) 24, 254
DpnII GATC 2 cut(s) 22, 252
EaeI YGGCCR 1 cut(s) 129
Eco130I CCWWGG 1 cut(s) 26
Eco57I CTGAAG 2 cut(s) 32, 267
EcoT14I CCWWGG 1 cut(s) 26
ErhI CCWWGG 1 cut(s) 26
Esp3I CGTCTC 1 cut(s) 218
FaeI CATG 2 cut(s) 110, 196
FaqI GGGAC 1 cut(s) 102
FatI CATG 2 cut(s) 106, 192
FspBI CTAG 2 cut(s) 27, 420
GlaI GCGC 1 cut(s) 200
GsaI CCCAGC 1 cut(s) 40
HaeIII GGCC 2 cut(s) 131, 415
HgaI GACGC 1 cut(s) 443
HhaI GCGC 1 cut(s) 201
Hin1II CATG 2 cut(s) 110, 196
Hin6I GCGC 1 cut(s) 199
HinP1I GCGC 1 cut(s) 199
HinfI GANTC 3 cut(s) 147, 262, 333
Hpy188I TCNGA 2 cut(s) 9, 152
Hpy188III TCNNGA 4 cut(s) 107, 122, 397, 449
HpyAV CCTTC 3 cut(s) 56, 222, 352
HpyCH4IV ACGT 1 cut(s) 211
HpyCH4V TGCA 2 cut(s) 367, 496
HpyF3I CTNAG 3 cut(s) 8, 450, 502
HpySE526I ACGT 1 cut(s) 211
Hsp92II CATG 2 cut(s) 110, 196
HspAI GCGC 1 cut(s) 199
Kzo9I GATC 2 cut(s) 22, 252
LpnPI CCDG 6 cut(s) 22, 113, 135, 317, 397, 462
MaeI CTAG 2 cut(s) 27, 420
MaeII ACGT 1 cut(s) 211
MaeIII GTNAC 1 cut(s) 512
MalI GATC 2 cut(s) 24, 254
MboI GATC 2 cut(s) 22, 252
MboII GAAGA 3 cut(s) 67, 254, 437
MluCI AATT 4 cut(s) 68, 217, 432, 497
MlyI GAGTC 1 cut(s) 256
MmeI TCCRAC 1 cut(s) 294
MnlI CCTC 3 cut(s) 3, 382, 447
MseI TTAA 2 cut(s) 84, 203
MspCI CTTAAG 1 cut(s) 83
NdeII GATC 2 cut(s) 22, 252
NlaIII CATG 2 cut(s) 110, 196
NspI RCATGY 1 cut(s) 196
PagI TCATGA 1 cut(s) 106
PciI ACATGT 1 cut(s) 192
PfeI GAWTC 2 cut(s) 147, 333
PleI GAGTC 1 cut(s) 256
PpsI GAGTC 1 cut(s) 256
PscI ACATGT 1 cut(s) 192
PspFI CCCAGC 1 cut(s) 36
PspPI GGNCC 1 cut(s) 414
RsaI GTAC 2 cut(s) 44, 210
RsaNI GTAC 2 cut(s) 43, 209
SaqAI TTAA 2 cut(s) 84, 203
Sau3AI GATC 2 cut(s) 22, 252
Sau96I GGNCC 1 cut(s) 414
SchI GAGTC 1 cut(s) 256
SetI ASST 8 cut(s) 48, 174, 210, 214, 275, 344, 393, 511
SmlI CTYRAG 1 cut(s) 83
SmoI CTYRAG 1 cut(s) 83
Sse9I AATT 4 cut(s) 68, 217, 432, 497
SspMI CTAG 2 cut(s) 27, 420
StyI CCWWGG 1 cut(s) 26
TaiI ACGT 1 cut(s) 214
TasI AATT 4 cut(s) 68, 217, 432, 497
TfiI GAWTC 2 cut(s) 147, 333
Tru1I TTAA 2 cut(s) 84, 203
Tru9I TTAA 2 cut(s) 84, 203
TscAI CASTG 1 cut(s) 143
TspDTI ATGAA 1 cut(s) 95
TspRI CASTG 1 cut(s) 143
Vha464I CTTAAG 1 cut(s) 83
XapI RAATTY 1 cut(s) 432
XceI RCATGY 1 cut(s) 196
XmaJI CCTAGG 1 cut(s) 26
XspI CTAG 2 cut(s) 27, 420
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.