Rmu_sc0001099.1_g000011

Receptor-like protein 12

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001099.1
N/A
Physical Location & Seq
Forward (+)
51145 .. 51933
789 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001099.1_g000011.1.cds

Sequence Viewer

Length: 579 bp
atggtgctcatccaaagacttcatcatggaaacccgaaggagaaaatagcagctgctgctcatgggagggtgtcgaatgtgatgaagagaccgaagctggacctctctgataattacttcaattactcccaaattcctactgccattaggaactttacaaggcttaggtatctcaacctctctgcctctgccatttgtggtcgtgccccattggaaggtcctttgtctttggttggtaagctaaccaaactcactgaatttcatcttaaaagcatcaatccaattggttacatcccatattctcttgaaaaccccacagtcactcatcttgatctttcgtttaatcgaccaactggtccaatcccatcttgggttggcagccttaccagactagttaaaataaatcttcgagtgaatgaactgcatggttcaattccagaatcattattcaatcttgtggagctcaagaggcttctttctcttactcatgatgctctgtctggtgtagtggacattttcaagctagaaaatctcatccatatccaactaggcggtaacaatctagaacccgaactctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0008150 GO:0009888 GO:0010073 GO:0032501 GO:0032502 GO:0048507 GO:0048856
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_6 LRR_8

Protein Analysis

192

Amino Acids

21.43

Weight (kDa)

9.59

Isoelectric Point (pI)

15.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 354
AciI CCGC 1 cut(s) 552
AcsI RAATTY 2 cut(s) 132, 257
AfiI CCNNNNNNNGG 2 cut(s) 215, 370
AgsI TTSAA 5 cut(s) 121, 308, 432, 451, 520
AhlI ACTAGT 1 cut(s) 391
AluBI AGCT 5 cut(s) 53, 97, 241, 463, 523
AluI AGCT 5 cut(s) 53, 97, 241, 463, 523
Alw21I GWGCWC 2 cut(s) 9, 465
Alw26I GTCTC 1 cut(s) 82
AlwNI CAGNNNCTG 1 cut(s) 56
ApeKI GCWGC 4 cut(s) 50, 53, 56, 378
ApoI RAATTY 2 cut(s) 132, 257
AspS9I GGNCC 3 cut(s) 100, 218, 356
AvaII GGWCC 3 cut(s) 100, 218, 356
BaeGI GKGCMC 1 cut(s) 208
BanII GRGCYC 1 cut(s) 465
Bbv12I GWGCWC 2 cut(s) 9, 465
BbvI GCAGC 4 cut(s) 40, 43, 62, 390
BccI CCATC 1 cut(s) 373
BcoDI GTCTC 1 cut(s) 82
BcuI ACTAGT 1 cut(s) 391
BfaI CTAG 5 cut(s) 392, 524, 548, 563, 577
BisI GCNGC 4 cut(s) 51, 54, 57, 379
BlsI GCNGC 4 cut(s) 52, 55, 58, 380
Bme18I GGWCC 3 cut(s) 100, 218, 356
BmgT120I GGNCC 3 cut(s) 100, 218, 356
BmsI GCATC 2 cut(s) 282, 481
Bpu10I CCTNAGC 1 cut(s) 164
BpuEI CTTGAG 1 cut(s) 449
BsaI GGTCTC 1 cut(s) 82
Bsc4I CCNNNNNNNGG 2 cut(s) 215, 370
Bse1I ACTGG 1 cut(s) 358
BseGI GGATG 3 cut(s) 9, 291, 534
BseLI CCNNNNNNNGG 2 cut(s) 215, 370
BseNI ACTGG 1 cut(s) 358
BseSI GKGCMC 1 cut(s) 208
BseXI GCAGC 4 cut(s) 40, 43, 62, 390
BsiHKAI GWGCWC 2 cut(s) 9, 465
BslI CCNNNNNNNGG 2 cut(s) 215, 370
BsmAI GTCTC 1 cut(s) 82
Bso31I GGTCTC 1 cut(s) 82
Bsp1286I GDGCHC 3 cut(s) 9, 208, 465
Bsp143I GATC 1 cut(s) 331
BspACI CCGC 1 cut(s) 552
BspHI TCATGA 1 cut(s) 487
BspTNI GGTCTC 1 cut(s) 82
BsrI ACTGG 1 cut(s) 358
BssMI GATC 1 cut(s) 331
Bst4CI ACNGT 1 cut(s) 319
Bst6I CTCTTC 1 cut(s) 80
BstAPI GCANNNNNTGC 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 164
BstF5I GGATG 3 cut(s) 9, 291, 534
BstKTI GATC 1 cut(s) 334
BstMAI GTCTC 1 cut(s) 82
BstMBI GATC 1 cut(s) 331
BstMWI GCNNNNNNNGC 2 cut(s) 56, 469
BstSLI GKGCMC 1 cut(s) 208
BstV1I GCAGC 4 cut(s) 40, 43, 62, 390
BtsCI GGATG 3 cut(s) 9, 291, 534
BtsIMutI CAGTG 1 cut(s) 252
CaiI CAGNNNCTG 1 cut(s) 56
CciI TCATGA 1 cut(s) 487
Cfr13I GGNCC 3 cut(s) 100, 218, 356
CviAII CATG 4 cut(s) 26, 62, 425, 488
CviJI RGCY 8 cut(s) 53, 97, 163, 241, 381, 463, 472, 523
CviKI_1 RGCY 8 cut(s) 53, 97, 163, 241, 381, 463, 472, 523
DdeI CTNAG 1 cut(s) 164
DpnI GATC 1 cut(s) 333
DpnII GATC 1 cut(s) 331
DrdI GACNNNNNNGTC 1 cut(s) 354
DseDI GACNNNNNNGTC 1 cut(s) 354
Eam1104I CTCTTC 1 cut(s) 80
EarI CTCTTC 1 cut(s) 80
Ecl136II GAGCTC 1 cut(s) 463
Eco24I GRGCYC 1 cut(s) 465
Eco31I GGTCTC 1 cut(s) 82
Eco47I GGWCC 3 cut(s) 100, 218, 356
Eco53kI GAGCTC 1 cut(s) 463
EcoICRI GAGCTC 1 cut(s) 463
EcoO109I RGGNCCY 1 cut(s) 218
EcoT38I GRGCYC 1 cut(s) 465
FaeI CATG 4 cut(s) 29, 65, 428, 491
FaiI YATR 6 cut(s) 27, 63, 298, 426, 489, 540
FatI CATG 4 cut(s) 25, 61, 424, 487
Fnu4HI GCNGC 4 cut(s) 51, 54, 57, 379
FokI GGATG 2 cut(s) 278, 521
FriOI GRGCYC 1 cut(s) 465
Fsp4HI GCNGC 4 cut(s) 51, 54, 57, 379
FspBI CTAG 5 cut(s) 392, 524, 548, 563, 577
GluI GCNGC 4 cut(s) 51, 54, 57, 379
Hin1II CATG 4 cut(s) 29, 65, 428, 491
HinfI GANTC 1 cut(s) 440
Hpy166II GTNNAC 1 cut(s) 511
Hpy188I TCNGA 1 cut(s) 109
Hpy188III TCNNGA 6 cut(s) 305, 329, 437, 466, 488, 563
Hpy8I GTNNAC 1 cut(s) 511
HpyAV CCTTC 2 cut(s) 31, 209
HpyCH4III ACNGT 1 cut(s) 319
HpyCH4V TGCA 1 cut(s) 424
HpyF10VI GCNNNNNNNGC 2 cut(s) 56, 469
HpyF3I CTNAG 1 cut(s) 164
Hsp92II CATG 4 cut(s) 29, 65, 428, 491
Kzo9I GATC 1 cut(s) 331
LmnI GCTCC 1 cut(s) 460
LpnPI CCDG 5 cut(s) 83, 339, 400, 450, 486
Lsp1109I GCAGC 4 cut(s) 40, 43, 62, 390
LweI GCATC 2 cut(s) 282, 481
MaeI CTAG 5 cut(s) 392, 524, 548, 563, 577
MaeIII GTNAC 3 cut(s) 287, 319, 554
MalI GATC 1 cut(s) 333
MboI GATC 1 cut(s) 331
MboII GAAGA 2 cut(s) 97, 398
MfeI CAATTG 1 cut(s) 282
MhlI GDGCHC 3 cut(s) 9, 208, 465
MluCI AATT 6 cut(s) 112, 121, 132, 257, 282, 432
MmeI TCCRAC 1 cut(s) 568
MnlI CCTC 5 cut(s) 60, 113, 188, 196, 462
MseI TTAA 3 cut(s) 267, 342, 396
MspA1I CMGCKG 1 cut(s) 53
MunI CAATTG 1 cut(s) 282
MwoI GCNNNNNNNGC 2 cut(s) 56, 469
NdeII GATC 1 cut(s) 331
NlaIII CATG 4 cut(s) 29, 65, 428, 491
NmuCI GTSAC 1 cut(s) 319
PagI TCATGA 1 cut(s) 487
PfeI GAWTC 1 cut(s) 440
PkrI GCNGC 4 cut(s) 52, 55, 58, 380
PpuMI RGGWCCY 1 cut(s) 218
Psp124BI GAGCTC 1 cut(s) 465
Psp5II RGGWCCY 1 cut(s) 218
PspPI GGNCC 3 cut(s) 100, 218, 356
PspPPI RGGWCCY 1 cut(s) 218
PstNI CAGNNNCTG 1 cut(s) 56
PvuII CAGCTG 1 cut(s) 53
SacI GAGCTC 1 cut(s) 465
SaqAI TTAA 3 cut(s) 267, 342, 396
SatI GCNGC 4 cut(s) 51, 54, 57, 379
Sau3AI GATC 1 cut(s) 331
Sau96I GGNCC 3 cut(s) 100, 218, 356
SduI GDGCHC 3 cut(s) 9, 208, 465
SetI ASST 9 cut(s) 55, 99, 105, 170, 180, 220, 243, 465, 525
SfaNI GCATC 2 cut(s) 282, 481
SinI GGWCC 3 cut(s) 100, 218, 356
SmlI CTYRAG 1 cut(s) 464
SmoI CTYRAG 1 cut(s) 464
SpeI ACTAGT 1 cut(s) 391
Sse9I AATT 6 cut(s) 112, 121, 132, 257, 282, 432
SsiI CCGC 1 cut(s) 552
SspMI CTAG 5 cut(s) 392, 524, 548, 563, 577
SstI GAGCTC 1 cut(s) 465
TaaI ACNGT 1 cut(s) 319
TaqI TCGA 3 cut(s) 74, 346, 409
TaqII GACCGA 1 cut(s) 106
TasI AATT 6 cut(s) 112, 121, 132, 257, 282, 432
TfiI GAWTC 1 cut(s) 440
Tru1I TTAA 3 cut(s) 267, 342, 396
Tru9I TTAA 3 cut(s) 267, 342, 396
TscAI CASTG 1 cut(s) 259
TseFI GTSAC 1 cut(s) 319
TseI GCWGC 4 cut(s) 50, 53, 56, 378
Tsp45I GTSAC 1 cut(s) 319
TspDTI ATGAA 4 cut(s) 11, 98, 251, 432
TspRI CASTG 1 cut(s) 259
VpaK11BI GGWCC 3 cut(s) 100, 218, 356
XapI RAATTY 2 cut(s) 132, 257
XbaI TCTAGA 1 cut(s) 562
XcmI CCANNNNNNNNNTGG 1 cut(s) 366
XspI CTAG 5 cut(s) 392, 524, 548, 563, 577
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.