Rmu_sc0001212.1_g000009

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001212.1
N/A
Physical Location & Seq
Reverse (-)
50823 .. 51233
411 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 411 bp
atggtagaggtagagtacaaaagctcatgggtgtggttcttagaatgtctgattaaagatttggagataaaaaatcagtgtgaatacactttcatctcagacaagcagaaagggctaatcaatgcttttgaaatagtggtgcctatcaaaggttctatatgtgttaggcatttgcttagtaacttcaagttgcaatttaaaggcaaggcgctaaaggacaagttatgggagtgtgcaagggctacaactgttctagaatttggaaggaagatggatgagatgaagaacttatccaaagaagcatttgtatggcttgcacagaatccacctaggcaatggtcgaagtcttacttcaacactattcccaaatgtgatatgctactgaataatatttgtgagtactacctataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBD_Tnp_Mut MULE SWIM

Protein Analysis

136

Amino Acids

16.1

Weight (kDa)

8.7

Isoelectric Point (pI)

26.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 139
AcsI RAATTY 1 cut(s) 257
AfaI GTAC 2 cut(s) 17, 401
AfiI CCNNNNNNNGG 1 cut(s) 149
AgsI TTSAA 3 cut(s) 131, 187, 355
AluBI AGCT 1 cut(s) 24
AluI AGCT 1 cut(s) 24
ApoI RAATTY 1 cut(s) 257
AspA2I CCTAGG 1 cut(s) 329
AspLEI GCGC 1 cut(s) 211
AvrII CCTAGG 1 cut(s) 329
BanI GGYRCC 1 cut(s) 139
BccI CCATC 1 cut(s) 265
BfaI CTAG 2 cut(s) 254, 330
BfoI RGCGCY 1 cut(s) 212
BlnI CCTAGG 1 cut(s) 329
BmcAI AGTACT 1 cut(s) 401
BmiI GGNNCC 1 cut(s) 141
BsaJI CCNNGG 1 cut(s) 329
Bsc4I CCNNNNNNNGG 1 cut(s) 149
Bse3DI GCAATG 1 cut(s) 341
BseDI CCNNGG 1 cut(s) 329
BseGI GGATG 1 cut(s) 280
BseLI CCNNNNNNNGG 1 cut(s) 149
BseMI GCAATG 1 cut(s) 341
BseMII CTCAG 1 cut(s) 111
BshNI GGYRCC 1 cut(s) 139
BslI CCNNNNNNNGG 1 cut(s) 149
BspCNI CTCAG 1 cut(s) 110
BspLI GGNNCC 1 cut(s) 141
BspT107I GGYRCC 1 cut(s) 139
BsrDI GCAATG 1 cut(s) 341
BssECI CCNNGG 1 cut(s) 329
BssT1I CCWWGG 1 cut(s) 329
Bst4CI ACNGT 1 cut(s) 250
BstC8I GCNNGC 1 cut(s) 315
BstDEI CTNAG 3 cut(s) 40, 97, 176
BstENI CCTNNNNNAGG 1 cut(s) 147
BstF5I GGATG 1 cut(s) 280
BstH2I RGCGCY 1 cut(s) 212
BstHHI GCGC 1 cut(s) 211
BstMWI GCNNNNNNNGC 1 cut(s) 112
BtsCI GGATG 1 cut(s) 280
BtsIMutI CAGTG 1 cut(s) 83
Cac8I GCNNGC 1 cut(s) 315
CfoI GCGC 1 cut(s) 211
Csp6I GTAC 2 cut(s) 16, 400
CviAII CATG 1 cut(s) 27
CviJI RGCY 4 cut(s) 24, 115, 242, 313
CviKI_1 RGCY 4 cut(s) 24, 115, 242, 313
CviQI GTAC 2 cut(s) 16, 400
DdeI CTNAG 3 cut(s) 40, 97, 176
DraI TTTAAA 1 cut(s) 199
Eco130I CCWWGG 1 cut(s) 329
EcoNI CCTNNNNNAGG 1 cut(s) 147
EcoT14I CCWWGG 1 cut(s) 329
ErhI CCWWGG 1 cut(s) 329
FaeI CATG 1 cut(s) 30
FaiI YATR 7 cut(s) 28, 158, 160, 226, 310, 377, 409
FalI AAGNNNNNCTT 2 cut(s) 335, 367
FatI CATG 1 cut(s) 26
FokI GGATG 1 cut(s) 287
FspBI CTAG 2 cut(s) 254, 330
GlaI GCGC 1 cut(s) 210
HaeII RGCGCY 1 cut(s) 212
HhaI GCGC 1 cut(s) 211
Hin1II CATG 1 cut(s) 30
Hin6I GCGC 1 cut(s) 209
HinP1I GCGC 1 cut(s) 209
HinfI GANTC 1 cut(s) 322
Hpy188I TCNGA 2 cut(s) 51, 100
Hpy188III TCNNGA 1 cut(s) 254
HpyAV CCTTC 1 cut(s) 258
HpyCH4III ACNGT 1 cut(s) 250
HpyCH4V TGCA 3 cut(s) 193, 236, 317
HpyF10VI GCNNNNNNNGC 1 cut(s) 112
HpyF3I CTNAG 3 cut(s) 40, 97, 176
Hsp92II CATG 1 cut(s) 30
HspAI GCGC 1 cut(s) 209
MaeI CTAG 2 cut(s) 254, 330
MaeIII GTNAC 1 cut(s) 179
MboII GAAGA 2 cut(s) 280, 295
MluCI AATT 2 cut(s) 194, 257
MseI TTAA 2 cut(s) 54, 198
MslI CAYNNNNRTG 2 cut(s) 31, 307
MwoI GCNNNNNNNGC 1 cut(s) 112
NlaIII CATG 1 cut(s) 30
NlaIV GGNNCC 1 cut(s) 141
PfeI GAWTC 1 cut(s) 322
PspN4I GGNNCC 1 cut(s) 141
RsaI GTAC 2 cut(s) 17, 401
RsaNI GTAC 2 cut(s) 16, 400
RseI CAYNNNNRTG 2 cut(s) 31, 307
SaqAI TTAA 2 cut(s) 54, 198
ScaI AGTACT 1 cut(s) 401
SetI ASST 5 cut(s) 12, 26, 154, 331, 408
SgeI CNNG 9 cut(s) 39, 115, 199, 217, 232, 249, 266, 326, 342
SmiMI CAYNNNNRTG 2 cut(s) 31, 307
Sse9I AATT 2 cut(s) 194, 257
SspI AATATT 1 cut(s) 391
SspMI CTAG 2 cut(s) 254, 330
StyI CCWWGG 1 cut(s) 329
TaaI ACNGT 1 cut(s) 250
TaqI TCGA 1 cut(s) 341
TasI AATT 2 cut(s) 194, 257
TatI WGTACW 2 cut(s) 15, 399
TfiI GAWTC 1 cut(s) 322
Tru1I TTAA 2 cut(s) 54, 198
Tru9I TTAA 2 cut(s) 54, 198
TscAI CASTG 1 cut(s) 83
TspDTI ATGAA 2 cut(s) 82, 296
TspRI CASTG 1 cut(s) 83
XagI CCTNNNNNAGG 1 cut(s) 147
XapI RAATTY 1 cut(s) 257
XbaI TCTAGA 1 cut(s) 253
XcmI CCANNNNNNNNNTGG 1 cut(s) 333
XmaJI CCTAGG 1 cut(s) 329
XspI CTAG 2 cut(s) 254, 330
ZrmI AGTACT 1 cut(s) 401
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.