Rmu_sc0001217.1_g000025

L-type lectin-domain containing receptor kinase IX.1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001217.1
N/A
Physical Location & Seq
Reverse (-)
101546 .. 101950
405 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001217.1_g000025.1.cds

Sequence Viewer

Length: 405 bp
atggggacagaagatttgaagcggattaaggtggctgcactaccttctttatttgattttattcttggagttggtgtatccatatattgtttggtggcaagcaagcgaaggaaaagcagtggcgtaattggtaatgaccttgagagacaagccttaccaaagcagtttagtcccgaagaattgcatgctgccaccaatggcttcgcaccacatagaagactaggccgaggagggtctggacaagtttatagaggactgctacaaggtctaggccgtgaagtagctatcaagaaaatctggacaggaactgatcagcactatgaggaaatttttatgaatgaagtcaaaataataaagccacttaatccatcgaaatatggtgcaattcattggatggtgtcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

134

Amino Acids

14.86

Weight (kDa)

9.76

Isoelectric Point (pI)

43.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 22
AcsI RAATTY 1 cut(s) 327
AgsI TTSAA 1 cut(s) 19
AluBI AGCT 1 cut(s) 284
AluI AGCT 1 cut(s) 284
Alw26I GTCTC 1 cut(s) 139
AlwNI CAGNNNCTG 1 cut(s) 308
AoxI GGCC 2 cut(s) 223, 271
ApeKI GCWGC 2 cut(s) 35, 188
ApoI RAATTY 1 cut(s) 327
ArsI GACNNNNNNTTYG 1 cut(s) 30
BbsI GAAGAC 1 cut(s) 223
BbvI GCAGC 2 cut(s) 22, 175
BccI CCATC 2 cut(s) 376, 388
BceAI ACGGC 1 cut(s) 258
BciVI GTATCC 1 cut(s) 88
BclI TGATCA 1 cut(s) 310
BcoDI GTCTC 1 cut(s) 139
BfaI CTAG 2 cut(s) 221, 269
BfuI GTATCC 1 cut(s) 88
BisI GCNGC 2 cut(s) 36, 189
BlsI GCNGC 2 cut(s) 37, 190
BpiI GAAGAC 1 cut(s) 223
BpuEI CTTGAG 1 cut(s) 161
BsaJI CCNNGG 1 cut(s) 226
BsaXI ACNNNNNCTCC 2 cut(s) 60, 90
BseDI CCNNGG 1 cut(s) 226
BseGI GGATG 1 cut(s) 399
BseRI GAGGAG 1 cut(s) 243
BseXI GCAGC 2 cut(s) 22, 175
BsgI GTGCAG 1 cut(s) 21
BshFI GGCC 2 cut(s) 225, 273
BslFI GGGAC 2 cut(s) 19, 156
BsmAI GTCTC 1 cut(s) 139
BsmFI GGGAC 2 cut(s) 19, 156
BsnI GGCC 2 cut(s) 225, 273
Bsp143I GATC 1 cut(s) 310
BspACI CCGC 1 cut(s) 22
BspANI GGCC 2 cut(s) 225, 273
BspHI TCATGA 1 cut(s) 401
BssECI CCNNGG 1 cut(s) 226
BssMI GATC 1 cut(s) 310
BstC8I GCNNGC 3 cut(s) 100, 104, 186
BstF5I GGATG 1 cut(s) 399
BstKTI GATC 1 cut(s) 313
BstMAI GTCTC 1 cut(s) 139
BstMBI GATC 1 cut(s) 310
BstNSI RCATGY 1 cut(s) 188
BstV1I GCAGC 2 cut(s) 22, 175
BstV2I GAAGAC 1 cut(s) 223
BsuI GTATCC 1 cut(s) 88
BsuRI GGCC 2 cut(s) 225, 273
BtsCI GGATG 1 cut(s) 399
BtsI GCAGTG 1 cut(s) 124
BtsIMutI CAGTG 1 cut(s) 124
Cac8I GCNNGC 3 cut(s) 100, 104, 186
CaiI CAGNNNCTG 1 cut(s) 308
CciI TCATGA 1 cut(s) 401
CviAII CATG 2 cut(s) 185, 402
CviJI RGCY 7 cut(s) 35, 152, 201, 225, 273, 284, 358
CviKI_1 RGCY 7 cut(s) 35, 152, 201, 225, 273, 284, 358
DpnI GATC 1 cut(s) 312
DpnII GATC 1 cut(s) 310
FaeI CATG 2 cut(s) 188, 405
FaiI YATR 9 cut(s) 83, 85, 186, 213, 249, 321, 335, 378, 403
FaqI GGGAC 2 cut(s) 19, 156
FatI CATG 2 cut(s) 184, 401
FbaI TGATCA 1 cut(s) 310
Fnu4HI GCNGC 2 cut(s) 36, 189
Fsp4HI GCNGC 2 cut(s) 36, 189
FspBI CTAG 2 cut(s) 221, 269
GluI GCNGC 2 cut(s) 36, 189
HaeIII GGCC 2 cut(s) 225, 273
Hin1II CATG 2 cut(s) 188, 405
Hpy188III TCNNGA 5 cut(s) 173, 237, 289, 298, 402
HpyAV CCTTC 2 cut(s) 54, 102
HpyCH4V TGCA 3 cut(s) 38, 184, 383
Hsp92II CATG 2 cut(s) 188, 405
Ksp22I TGATCA 1 cut(s) 310
Kzo9I GATC 1 cut(s) 310
LpnPI CCDG 3 cut(s) 222, 283, 288
Lsp1109I GCAGC 2 cut(s) 22, 175
MaeI CTAG 2 cut(s) 221, 269
MalI GATC 1 cut(s) 312
MboI GATC 1 cut(s) 310
MboII GAAGA 3 cut(s) 23, 188, 228
MluCI AATT 4 cut(s) 126, 179, 327, 384
MnlI CCTC 4 cut(s) 221, 224, 245, 316
MseI TTAA 2 cut(s) 27, 363
NdeII GATC 1 cut(s) 310
NlaIII CATG 2 cut(s) 188, 405
NmeAIII GCCGAG 1 cut(s) 251
NspI RCATGY 1 cut(s) 188
PaeI GCATGC 1 cut(s) 188
PagI TCATGA 1 cut(s) 401
PkrI GCNGC 2 cut(s) 37, 190
PstNI CAGNNNCTG 1 cut(s) 308
SaqAI TTAA 2 cut(s) 27, 363
SatI GCNGC 2 cut(s) 36, 189
Sau3AI GATC 1 cut(s) 310
SetI ASST 5 cut(s) 33, 46, 141, 268, 286
SmlI CTYRAG 1 cut(s) 140
SmoI CTYRAG 1 cut(s) 140
SphI GCATGC 1 cut(s) 188
Sse9I AATT 4 cut(s) 126, 179, 327, 384
SsiI CCGC 1 cut(s) 22
SspMI CTAG 2 cut(s) 221, 269
TaqI TCGA 1 cut(s) 371
TasI AATT 4 cut(s) 126, 179, 327, 384
Tru1I TTAA 2 cut(s) 27, 363
Tru9I TTAA 2 cut(s) 27, 363
TscAI CASTG 1 cut(s) 124
TseI GCWGC 2 cut(s) 35, 188
TspDTI ATGAA 3 cut(s) 350, 354, 377
TspRI CASTG 1 cut(s) 124
XapI RAATTY 1 cut(s) 327
XceI RCATGY 1 cut(s) 188
XcmI CCANNNNNNNNNTGG 1 cut(s) 88
XspI CTAG 2 cut(s) 221, 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.