Rmu_sc0001423.1_g000052

ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001423.1
N/A
Physical Location & Seq
Forward (+)
243840 .. 245684
1845 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001423.1_g000052.1.cds

Sequence Viewer

Length: 483 bp
atggttgctgcagctagaaacgtaaacattaggcaactatttcaagagagatatgctaactctctggcttattgtgtggatcaaagtttttcatgtgctctaccgcatcacaacctcagatttgagaaggcacaagattcaggaaggtttagatatgcaagggatacatcattcagaaagagtcatttgaacttctggagccagtgtgcttcttcagacagtttttcgggcagttactatgagtacctgactctgaggcatggttttatctcggcacatttagcacctgagatcatttattctcatgctaatgggcatagatggacggggagatatgaagctcatttatggaacaaaggatcttggaatccaagacaaaggaacaagggaaaacaggggcttatgacgaagaagaatccacagcaaaaagttggcagcactcaagtagcggggaacatcaacttctacaaattgatctgttga

Protein Analysis

160

Amino Acids

18.54

Weight (kDa)

9.93

Isoelectric Point (pI)

43.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 104, 449
AclWI GGATC 2 cut(s) 87, 367
AcuI CTGAAG 1 cut(s) 198
AfaI GTAC 1 cut(s) 245
AgsI TTSAA 2 cut(s) 44, 190
AluBI AGCT 2 cut(s) 14, 341
AluI AGCT 2 cut(s) 14, 341
Alw21I GWGCWC 1 cut(s) 100
AlwI GGATC 2 cut(s) 87, 367
ApeKI GCWGC 3 cut(s) 8, 11, 435
Bbv12I GWGCWC 1 cut(s) 100
BbvI GCAGC 2 cut(s) 23, 447
BccI CCATC 1 cut(s) 315
BciVI GTATCC 1 cut(s) 157
BfaI CTAG 1 cut(s) 15
BfmI CTRYAG 1 cut(s) 9
BfuI GTATCC 1 cut(s) 157
BisI GCNGC 3 cut(s) 9, 12, 436
BlsI GCNGC 3 cut(s) 10, 13, 437
BmiI GGNNCC 1 cut(s) 200
BmsI GCATC 1 cut(s) 115
BpmI CTGGAG 1 cut(s) 217
BpuEI CTTGAG 1 cut(s) 426
BsaXI ACNNNNNCTCC 2 cut(s) 190, 220
Bse1I ACTGG 1 cut(s) 202
BseMII CTCAG 3 cut(s) 130, 245, 279
BseNI ACTGG 1 cut(s) 202
BseXI GCAGC 2 cut(s) 23, 447
BsiHKAI GWGCWC 1 cut(s) 100
Bsp1286I GDGCHC 1 cut(s) 100
Bsp143I GATC 4 cut(s) 79, 291, 359, 474
BspACI CCGC 2 cut(s) 104, 449
BspCNI CTCAG 3 cut(s) 129, 246, 280
BspLI GGNNCC 1 cut(s) 200
BspMAI CTGCAG 1 cut(s) 13
BspPI GGATC 2 cut(s) 87, 367
BsrI ACTGG 1 cut(s) 202
BssMI GATC 4 cut(s) 79, 291, 359, 474
Bst4CI ACNGT 1 cut(s) 221
BstDEI CTNAG 3 cut(s) 116, 254, 288
BstKTI GATC 4 cut(s) 82, 294, 362, 477
BstMBI GATC 4 cut(s) 79, 291, 359, 474
BstMWI GCNNNNNNNGC 1 cut(s) 281
BstSFI CTRYAG 1 cut(s) 9
BstV1I GCAGC 2 cut(s) 23, 447
BstX2I RGATCY 1 cut(s) 359
BstYI RGATCY 1 cut(s) 359
BsuI GTATCC 1 cut(s) 157
BtsIMutI CAGTG 1 cut(s) 209
Csp6I GTAC 1 cut(s) 244
CviAII CATG 3 cut(s) 93, 260, 305
CviJI RGCY 5 cut(s) 14, 68, 201, 341, 400
CviKI_1 RGCY 5 cut(s) 14, 68, 201, 341, 400
CviQI GTAC 1 cut(s) 244
DdeI CTNAG 3 cut(s) 116, 254, 288
DpnI GATC 4 cut(s) 81, 293, 361, 476
DpnII GATC 4 cut(s) 79, 291, 359, 474
Eco57I CTGAAG 1 cut(s) 198
FaeI CATG 3 cut(s) 96, 263, 308
FatI CATG 3 cut(s) 92, 259, 304
FauI CCCGC 1 cut(s) 442
Fnu4HI GCNGC 3 cut(s) 9, 12, 436
Fsp4HI GCNGC 3 cut(s) 9, 12, 436
FspBI CTAG 1 cut(s) 15
GluI GCNGC 3 cut(s) 9, 12, 436
GsuI CTGGAG 1 cut(s) 217
Hin1II CATG 3 cut(s) 96, 263, 308
HinfI GANTC 5 cut(s) 137, 181, 250, 367, 415
Hpy166II GTNNAC 1 cut(s) 25
Hpy188I TCNGA 4 cut(s) 119, 176, 217, 255
Hpy188III TCNNGA 3 cut(s) 44, 141, 196
Hpy8I GTNNAC 1 cut(s) 25
HpyAV CCTTC 2 cut(s) 121, 138
HpyCH4III ACNGT 1 cut(s) 221
HpyCH4IV ACGT 1 cut(s) 21
HpyCH4V TGCA 2 cut(s) 11, 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 281
HpyF3I CTNAG 3 cut(s) 116, 254, 288
HpySE526I ACGT 1 cut(s) 21
Hsp92II CATG 3 cut(s) 96, 263, 308
Kzo9I GATC 4 cut(s) 79, 291, 359, 474
LmnI GCTCC 1 cut(s) 198
LpnPI CCDG 7 cut(s) 50, 126, 181, 215, 260, 300, 380
Lsp1109I GCAGC 2 cut(s) 23, 447
LweI GCATC 1 cut(s) 115
MaeI CTAG 1 cut(s) 15
MaeII ACGT 1 cut(s) 21
MaeIII GTNAC 1 cut(s) 233
MalI GATC 4 cut(s) 81, 293, 361, 476
MboI GATC 4 cut(s) 79, 291, 359, 474
MboII GAAGA 3 cut(s) 204, 421, 424
MflI RGATCY 1 cut(s) 359
MhlI GDGCHC 1 cut(s) 100
MluCI AATT 1 cut(s) 470
MlyI GAGTC 2 cut(s) 190, 244
MnlI CCTC 2 cut(s) 125, 249
MslI CAYNNNNRTG 1 cut(s) 309
MwoI GCNNNNNNNGC 1 cut(s) 281
NdeII GATC 4 cut(s) 79, 291, 359, 474
NlaIII CATG 3 cut(s) 96, 263, 308
NlaIV GGNNCC 1 cut(s) 200
NmeAIII GCCGAG 1 cut(s) 251
PfeI GAWTC 3 cut(s) 137, 367, 415
PkrI GCNGC 3 cut(s) 10, 13, 437
PleI GAGTC 2 cut(s) 189, 244
PpsI GAGTC 2 cut(s) 189, 244
PspN4I GGNNCC 1 cut(s) 200
PstI CTGCAG 1 cut(s) 13
PsuI RGATCY 1 cut(s) 359
RsaI GTAC 1 cut(s) 245
RsaNI GTAC 1 cut(s) 244
RseI CAYNNNNRTG 1 cut(s) 309
SatI GCNGC 3 cut(s) 9, 12, 436
Sau3AI GATC 4 cut(s) 79, 291, 359, 474
SchI GAGTC 2 cut(s) 190, 244
SduI GDGCHC 1 cut(s) 100
SetI ASST 7 cut(s) 16, 24, 117, 149, 249, 289, 343
SfaNI GCATC 1 cut(s) 115
SfcI CTRYAG 1 cut(s) 9
SmiMI CAYNNNNRTG 1 cut(s) 309
SmlI CTYRAG 1 cut(s) 441
SmoI CTYRAG 1 cut(s) 441
Sse9I AATT 1 cut(s) 470
SsiI CCGC 2 cut(s) 104, 449
SspMI CTAG 1 cut(s) 15
TaaI ACNGT 1 cut(s) 221
TaiI ACGT 1 cut(s) 24
TasI AATT 1 cut(s) 470
TfiI GAWTC 3 cut(s) 137, 367, 415
TscAI CASTG 1 cut(s) 209
TseI GCWGC 3 cut(s) 8, 11, 435
TspDTI ATGAA 2 cut(s) 81, 351
TspRI CASTG 1 cut(s) 209
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.