Rmu_sc0001460.1_g000029

auxin-induced protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001460.1
N/A
Physical Location & Seq
Forward (+)
129900 .. 131713
1814 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 252 bp
atgccgaggcgagcccggggcgcgctccgaaggcgagctgtgatgcggcctgggcgcaaggaagaaggtgaagttggtgagagccagaagaagcggtttgtgattccaatatcatatctgaatgagcctctgttcatggatttgttgaatcaagctcatgaagaatttggatacaatcatcccatgggtggtatcacaatcccctgcagtgaatacaccttccttgatctcgtttctcgcttaagtgtgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Auxin_inducible

Protein Analysis

83

Amino Acids

9.56

Weight (kDa)

9.42

Isoelectric Point (pI)

52.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 27 - 80 2.2e-16 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 23
AciI CCGC 2 cut(s) 46, 94
AcsI RAATTY 1 cut(s) 164
AfiI CCNNNNNNNGG 1 cut(s) 188
AflII CTTAAG 1 cut(s) 241
AgsI TTSAA 1 cut(s) 148
AjnI CCWGG 1 cut(s) 49
AjuI GAANNNNNNNTTGG 2 cut(s) 57, 89
AluBI AGCT 2 cut(s) 38, 155
AluI AGCT 2 cut(s) 38, 155
Ama87I CYCGRG 1 cut(s) 15
AoxI GGCC 1 cut(s) 47
ApoI RAATTY 1 cut(s) 164
AspLEI GCGC 3 cut(s) 23, 25, 57
AsuC2I CCSGG 2 cut(s) 16, 17
AsuHPI GGTGA 2 cut(s) 80, 89
AvaI CYCGRG 1 cut(s) 15
BanII GRGCYC 1 cut(s) 16
BciT130I CCWGG 1 cut(s) 51
BciVI GTATCC 1 cut(s) 164
BcnI CCSGG 2 cut(s) 16, 17
BfmI CTRYAG 1 cut(s) 205
BfrI CTTAAG 1 cut(s) 241
BfuI GTATCC 1 cut(s) 164
BisI GCNGC 1 cut(s) 47
BlsI GCNGC 1 cut(s) 48
Bme1390I CCNGG 3 cut(s) 16, 17, 51
BmeT110I CYCGRG 1 cut(s) 15
BmrFI CCNGG 3 cut(s) 16, 17, 51
BmsI GCATC 1 cut(s) 33
BpuMI CCSGG 2 cut(s) 16, 17
BsaJI CCNNGG 5 cut(s) 5, 15, 16, 50, 183
Bsc4I CCNNNNNNNGG 1 cut(s) 188
BseBI CCWGG 1 cut(s) 51
BseDI CCNNGG 5 cut(s) 5, 15, 16, 50, 183
BseGI GGATG 1 cut(s) 178
BseLI CCNNNNNNNGG 1 cut(s) 188
BsePI GCGCGC 1 cut(s) 21
Bsh1236I CGCG 1 cut(s) 23
BshFI GGCC 1 cut(s) 49
BsiHKCI CYCGRG 1 cut(s) 15
BsiSI CCGG 1 cut(s) 16
BslI CCNNNNNNNGG 1 cut(s) 188
BsnI GGCC 1 cut(s) 49
BsoBI CYCGRG 1 cut(s) 15
Bsp1286I GDGCHC 1 cut(s) 16
Bsp143I GATC 1 cut(s) 226
Bsp19I CCATGG 1 cut(s) 183
BspACI CCGC 2 cut(s) 46, 94
BspANI GGCC 1 cut(s) 49
BspFNI CGCG 1 cut(s) 23
BspHI TCATGA 1 cut(s) 157
BspMAI CTGCAG 1 cut(s) 209
BspTI CTTAAG 1 cut(s) 241
BssECI CCNNGG 5 cut(s) 5, 15, 16, 50, 183
BssHII GCGCGC 1 cut(s) 21
BssMI GATC 1 cut(s) 226
BssT1I CCWWGG 1 cut(s) 183
Bst2UI CCWGG 1 cut(s) 51
BstAFI CTTAAG 1 cut(s) 241
BstC8I GCNNGC 3 cut(s) 12, 23, 36
BstDSI CCRYGG 1 cut(s) 183
BstF5I GGATG 1 cut(s) 178
BstFNI CGCG 1 cut(s) 23
BstHHI GCGC 3 cut(s) 23, 25, 57
BstKTI GATC 1 cut(s) 229
BstMBI GATC 1 cut(s) 226
BstMWI GCNNNNNNNGC 3 cut(s) 20, 31, 52
BstNI CCWGG 1 cut(s) 51
BstSCI CCNGG 3 cut(s) 14, 15, 49
BstSFI CTRYAG 1 cut(s) 205
BstUI CGCG 1 cut(s) 23
BsuI GTATCC 1 cut(s) 164
BsuRI GGCC 1 cut(s) 49
BtgI CCRYGG 1 cut(s) 183
BtsCI GGATG 1 cut(s) 178
BtsI GCAGTG 1 cut(s) 214
BtsIMutI CAGTG 1 cut(s) 214
Cac8I GCNNGC 3 cut(s) 12, 23, 36
CciI TCATGA 1 cut(s) 157
CfoI GCGC 3 cut(s) 23, 25, 57
Cfr9I CCCGGG 1 cut(s) 15
CviAII CATG 3 cut(s) 136, 158, 184
CviJI RGCY 6 cut(s) 14, 38, 49, 84, 127, 155
CviKI_1 RGCY 6 cut(s) 14, 38, 49, 84, 127, 155
DpnI GATC 1 cut(s) 228
DpnII GATC 1 cut(s) 226
Eco130I CCWWGG 1 cut(s) 183
Eco24I GRGCYC 1 cut(s) 16
Eco88I CYCGRG 1 cut(s) 15
EcoRII CCWGG 1 cut(s) 49
EcoT14I CCWWGG 1 cut(s) 183
EcoT38I GRGCYC 1 cut(s) 16
ErhI CCWWGG 1 cut(s) 183
FaeI CATG 3 cut(s) 139, 161, 187
FaiI YATR 4 cut(s) 115, 137, 159, 185
FatI CATG 3 cut(s) 135, 157, 183
Fnu4HI GCNGC 1 cut(s) 47
FokI GGATG 1 cut(s) 165
FriOI GRGCYC 1 cut(s) 16
Fsp4HI GCNGC 1 cut(s) 47
GlaI GCGC 3 cut(s) 22, 24, 56
GluI GCNGC 1 cut(s) 47
HaeIII GGCC 1 cut(s) 49
HapII CCGG 1 cut(s) 16
HhaI GCGC 3 cut(s) 23, 25, 57
Hin1II CATG 3 cut(s) 139, 161, 187
Hin6I GCGC 3 cut(s) 21, 23, 55
HinP1I GCGC 3 cut(s) 21, 23, 55
HinfI GANTC 2 cut(s) 103, 148
HpaII CCGG 1 cut(s) 16
HphI GGTGA 2 cut(s) 80, 89
Hpy188I TCNGA 2 cut(s) 29, 120
Hpy188III TCNNGA 1 cut(s) 158
HpyAV CCTTC 3 cut(s) 24, 59, 229
HpyCH4V TGCA 1 cut(s) 207
HpyF10VI GCNNNNNNNGC 3 cut(s) 20, 31, 52
Hsp92II CATG 3 cut(s) 139, 161, 187
HspAI GCGC 3 cut(s) 21, 23, 55
Kzo9I GATC 1 cut(s) 226
LmnI GCTCC 1 cut(s) 30
LpnPI CCDG 5 cut(s) 29, 36, 63, 98, 217
LweI GCATC 1 cut(s) 33
MalI GATC 1 cut(s) 228
MboI GATC 1 cut(s) 226
MboII GAAGA 3 cut(s) 74, 100, 173
MhlI GDGCHC 1 cut(s) 16
MluCI AATT 1 cut(s) 164
MnlI CCTC 1 cut(s) 138
MseI TTAA 1 cut(s) 242
MspCI CTTAAG 1 cut(s) 241
MspI CCGG 1 cut(s) 16
MspR9I CCNGG 3 cut(s) 16, 17, 51
MvaI CCWGG 1 cut(s) 51
MvnI CGCG 1 cut(s) 23
MwoI GCNNNNNNNGC 3 cut(s) 20, 31, 52
NciI CCSGG 2 cut(s) 16, 17
NcoI CCATGG 1 cut(s) 183
NdeII GATC 1 cut(s) 226
NlaIII CATG 3 cut(s) 139, 161, 187
NmeAIII GCCGAG 1 cut(s) 30
PagI TCATGA 1 cut(s) 157
PauI GCGCGC 1 cut(s) 21
PfeI GAWTC 2 cut(s) 103, 148
PkrI GCNGC 1 cut(s) 48
Psp6I CCWGG 1 cut(s) 49
PspGI CCWGG 1 cut(s) 49
PstI CTGCAG 1 cut(s) 209
PteI GCGCGC 1 cut(s) 21
SaqAI TTAA 1 cut(s) 242
SatI GCNGC 1 cut(s) 47
Sau3AI GATC 1 cut(s) 226
ScrFI CCNGG 3 cut(s) 16, 17, 51
SduI GDGCHC 1 cut(s) 16
SetI ASST 4 cut(s) 40, 70, 157, 221
SfaNI GCATC 1 cut(s) 33
SfcI CTRYAG 1 cut(s) 205
SmaI CCCGGG 1 cut(s) 17
SmlI CTYRAG 1 cut(s) 241
SmoI CTYRAG 1 cut(s) 241
Sse9I AATT 1 cut(s) 164
SsiI CCGC 2 cut(s) 46, 94
StyD4I CCNGG 3 cut(s) 14, 15, 49
StyI CCWWGG 1 cut(s) 183
TasI AATT 1 cut(s) 164
TauI GCSGC 1 cut(s) 49
TfiI GAWTC 2 cut(s) 103, 148
Tru1I TTAA 1 cut(s) 242
Tru9I TTAA 1 cut(s) 242
TscAI CASTG 1 cut(s) 214
TspDTI ATGAA 2 cut(s) 124, 174
TspMI CCCGGG 1 cut(s) 15
TspRI CASTG 1 cut(s) 214
Vha464I CTTAAG 1 cut(s) 241
XapI RAATTY 1 cut(s) 164
XmaI CCCGGG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.