Rmu_sc0001484.1_g000001

L-type lectin-domain containing receptor kinase IX.1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001484.1
N/A
Physical Location & Seq
Forward (+)
3217 .. 3936
720 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001484.1_g000001.1.cds

Sequence Viewer

Length: 720 bp
atgagcaaggtgaatgcttacttgtttatgtatatatgcttaacagcagccttgacacgcatctatttggctccaaggcaacggtataagatagctttaggcttggcctcagcccttcattatctacacaacgatgcagagcagtgtgtccttcatagggatatcaaatcagctgttctgttggacaacgattttagcactaaatttggtgattttgggattgctaagcttgtggatccgcagttaaggtctcagactacagggctagttgggacttttggatacatgcatgtatccaccatatggctccagaatatgttattgaagggaaggcaagcaaagaatcagacatgtttagctttggagttgtggccttggaaatttgttgtggaaggaggacttaccacgacggagaattccacttaccgctttataggtgggtttggcatttgtaccttgcaggaaatttactggatgcagctgaagaaagtgggtgtagattttgagaaaaatgaaatggagtgctttttaattgttggattatggtgcactcatcccagcagcaacgaaaggccaaaagcaggacaagtgattaaggttttccagcttgaagcaccattgccaaaacttccacatatcatgcctgattacccaatgcctcaaccccattaccccaacaaaaagctcaatctggctcctctctgtctcagttattcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lectin_legB Pkinase

Protein Analysis

239

Amino Acids

27.21

Weight (kDa)

8.89

Isoelectric Point (pI)

47.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 303
AciI CCGC 2 cut(s) 239, 427
AclWI GGATC 2 cut(s) 230, 243
AcsI RAATTY 4 cut(s) 203, 380, 415, 465
AcuI CTGAAG 1 cut(s) 503
AfaI GTAC 1 cut(s) 454
AfiI CCNNNNNNNGG 3 cut(s) 157, 303, 581
AflIII ACRYGT 1 cut(s) 350
AgsI TTSAA 2 cut(s) 325, 611
AluBI AGCT 7 cut(s) 95, 173, 229, 359, 481, 607, 685
AluI AGCT 7 cut(s) 95, 173, 229, 359, 481, 607, 685
Alw21I GWGCWC 1 cut(s) 551
Alw26I GTCTC 2 cut(s) 255, 710
Alw44I GTGCAC 1 cut(s) 547
AlwI GGATC 2 cut(s) 230, 243
AoxI GGCC 3 cut(s) 105, 371, 572
ApaLI GTGCAC 1 cut(s) 547
ApeKI GCWGC 3 cut(s) 47, 478, 561
ApoI RAATTY 4 cut(s) 203, 380, 415, 465
AsuHPI GGTGA 2 cut(s) 22, 221
BaeGI GKGCMC 1 cut(s) 551
BamHI GGATCC 1 cut(s) 235
Bbv12I GWGCWC 1 cut(s) 551
BbvCI CCTCAGC 1 cut(s) 109
BbvI GCAGC 3 cut(s) 59, 490, 573
BciVI GTATCC 2 cut(s) 275, 304
BcoDI GTCTC 2 cut(s) 255, 710
BfaI CTAG 1 cut(s) 266
BfmI CTRYAG 1 cut(s) 258
BfuI GTATCC 2 cut(s) 275, 304
BisI GCNGC 3 cut(s) 48, 479, 562
BlpI GCTNAGC 1 cut(s) 225
BlsI GCNGC 3 cut(s) 49, 480, 563
BmiI GGNNCC 4 cut(s) 72, 237, 308, 696
BmsI GCATC 3 cut(s) 69, 124, 465
BpmI CTGGAG 1 cut(s) 293
Bpu10I CCTNAGC 1 cut(s) 109
Bpu1102I GCTNAGC 1 cut(s) 225
BsaI GGTCTC 1 cut(s) 255
BsaJI CCNNGG 2 cut(s) 74, 374
Bsc4I CCNNNNNNNGG 3 cut(s) 157, 303, 581
Bse1I ACTGG 1 cut(s) 476
Bse3DI GCAATG 1 cut(s) 617
BseDI CCNNGG 2 cut(s) 74, 374
BseGI GGATG 2 cut(s) 480, 553
BseLI CCNNNNNNNGG 3 cut(s) 157, 303, 581
BseMI GCAATG 1 cut(s) 617
BseMII CTCAG 2 cut(s) 123, 266
BseNI ACTGG 1 cut(s) 476
BseRI GAGGAG 1 cut(s) 687
BseSI GKGCMC 1 cut(s) 551
BseXI GCAGC 3 cut(s) 59, 490, 573
BseYI CCCAGC 1 cut(s) 557
BshFI GGCC 3 cut(s) 107, 373, 574
BsiHKAI GWGCWC 1 cut(s) 551
BslFI GGGAC 1 cut(s) 286
BslI CCNNNNNNNGG 3 cut(s) 157, 303, 581
BsmAI GTCTC 2 cut(s) 255, 710
BsmFI GGGAC 1 cut(s) 286
BsmI GAATGC 1 cut(s) 19
BsnI GGCC 3 cut(s) 107, 373, 574
Bso31I GGTCTC 1 cut(s) 255
Bsp1286I GDGCHC 1 cut(s) 551
Bsp143I GATC 1 cut(s) 235
Bsp1720I GCTNAGC 1 cut(s) 225
BspACI CCGC 2 cut(s) 239, 427
BspANI GGCC 3 cut(s) 107, 373, 574
BspCNI CTCAG 3 cut(s) 122, 265, 720
BspLI GGNNCC 4 cut(s) 72, 237, 308, 696
BspPI GGATC 2 cut(s) 230, 243
BspTNI GGTCTC 1 cut(s) 255
BsrDI GCAATG 1 cut(s) 617
BsrI ACTGG 1 cut(s) 476
BssECI CCNNGG 2 cut(s) 74, 374
BssMI GATC 1 cut(s) 235
BssT1I CCWWGG 2 cut(s) 74, 374
Bst4CI ACNGT 1 cut(s) 84
BstC8I GCNNGC 1 cut(s) 336
BstDEI CTNAG 4 cut(s) 109, 225, 252, 707
BstF5I GGATG 2 cut(s) 480, 553
BstKTI GATC 1 cut(s) 238
BstMAI GTCTC 2 cut(s) 255, 710
BstMBI GATC 1 cut(s) 235
BstNSI RCATGY 3 cut(s) 289, 293, 354
BstSFI CTRYAG 1 cut(s) 258
BstSLI GKGCMC 1 cut(s) 551
BstV1I GCAGC 3 cut(s) 59, 490, 573
BstX2I RGATCY 1 cut(s) 235
BstYI RGATCY 1 cut(s) 235
BsuI GTATCC 2 cut(s) 275, 304
BsuRI GGCC 3 cut(s) 107, 373, 574
BtsCI GGATG 2 cut(s) 480, 553
BtsI GCAGTG 1 cut(s) 149
BtsIMutI CAGTG 1 cut(s) 149
Cac8I GCNNGC 1 cut(s) 336
Csp6I GTAC 1 cut(s) 453
CviAII CATG 4 cut(s) 286, 290, 351, 640
CviQI GTAC 1 cut(s) 453
DdeI CTNAG 4 cut(s) 109, 225, 252, 707
DpnI GATC 1 cut(s) 237
DpnII GATC 1 cut(s) 235
Eco130I CCWWGG 2 cut(s) 74, 374
Eco31I GGTCTC 1 cut(s) 255
Eco32I GATATC 1 cut(s) 163
Eco57I CTGAAG 1 cut(s) 503
EcoRI GAATTC 1 cut(s) 415
EcoRV GATATC 1 cut(s) 163
EcoT14I CCWWGG 2 cut(s) 74, 374
EcoT22I ATGCAT 1 cut(s) 291
ErhI CCWWGG 2 cut(s) 74, 374
FaeI CATG 4 cut(s) 289, 293, 354, 643
FalI AAGNNNNNCTT 2 cut(s) 384, 416
FaqI GGGAC 1 cut(s) 286
FatI CATG 4 cut(s) 285, 289, 350, 639
FauNDI CATATG 1 cut(s) 302
Fnu4HI GCNGC 3 cut(s) 48, 479, 562
FokI GGATG 2 cut(s) 487, 540
Fsp4HI GCNGC 3 cut(s) 48, 479, 562
FspBI CTAG 1 cut(s) 266
GluI GCNGC 3 cut(s) 48, 479, 562
GsaI CCCAGC 1 cut(s) 561
GsuI CTGGAG 1 cut(s) 293
HaeIII GGCC 3 cut(s) 107, 373, 574
Hin1II CATG 4 cut(s) 289, 293, 354, 643
HindIII AAGCTT 1 cut(s) 227
HinfI GANTC 1 cut(s) 343
HphI GGTGA 2 cut(s) 22, 221
Hpy166II GTNNAC 1 cut(s) 549
Hpy188I TCNGA 2 cut(s) 255, 348
Hpy188III TCNNGA 1 cut(s) 310
Hpy8I GTNNAC 1 cut(s) 549
Hpy99I CGWCG 1 cut(s) 412
HpyAV CCTTC 5 cut(s) 125, 161, 319, 324, 386
HpyCH4III ACNGT 1 cut(s) 84
HpyCH4V TGCA 5 cut(s) 137, 289, 460, 478, 549
HpyF3I CTNAG 4 cut(s) 109, 225, 252, 707
Hsp92II CATG 4 cut(s) 289, 293, 354, 643
Kzo9I GATC 1 cut(s) 235
LmnI GCTCC 3 cut(s) 76, 312, 700
LpnPI CCDG 9 cut(s) 246, 323, 446, 457, 567, 571, 617, 657, 677
Lsp1109I GCAGC 3 cut(s) 59, 490, 573
LweI GCATC 3 cut(s) 69, 124, 465
MaeI CTAG 1 cut(s) 266
MalI GATC 1 cut(s) 237
MboI GATC 1 cut(s) 235
MboII GAAGA 1 cut(s) 496
MflI RGATCY 1 cut(s) 235
MhlI GDGCHC 1 cut(s) 551
MluCI AATT 5 cut(s) 203, 380, 415, 465, 531
MmeI TCCRAC 2 cut(s) 162, 517
MnlI CCTC 4 cut(s) 118, 389, 669, 708
Mph1103I ATGCAT 1 cut(s) 291
MseI TTAA 5 cut(s) 41, 245, 530, 594, 718
MslI CAYNNNNRTG 1 cut(s) 132
MspA1I CMGCKG 2 cut(s) 173, 481
Mva1269I GAATGC 1 cut(s) 19
NdeI CATATG 1 cut(s) 302
NdeII GATC 1 cut(s) 235
NlaIII CATG 4 cut(s) 289, 293, 354, 643
NlaIV GGNNCC 4 cut(s) 72, 237, 308, 696
NsiI ATGCAT 1 cut(s) 291
NspI RCATGY 3 cut(s) 289, 293, 354
PciI ACATGT 1 cut(s) 350
PctI GAATGC 1 cut(s) 19
PfeI GAWTC 1 cut(s) 343
PflMI CCANNNNNTGG 1 cut(s) 303
PkrI GCNGC 3 cut(s) 49, 480, 563
PscI ACATGT 1 cut(s) 350
PspFI CCCAGC 1 cut(s) 557
PspN4I GGNNCC 4 cut(s) 72, 237, 308, 696
PsuI RGATCY 1 cut(s) 235
PvuII CAGCTG 2 cut(s) 173, 481
RsaI GTAC 1 cut(s) 454
RsaNI GTAC 1 cut(s) 453
RseI CAYNNNNRTG 1 cut(s) 132
SaqAI TTAA 5 cut(s) 41, 245, 530, 594, 718
SatI GCNGC 3 cut(s) 48, 479, 562
Sau3AI GATC 1 cut(s) 235
SduI GDGCHC 1 cut(s) 551
SfaNI GCATC 3 cut(s) 69, 124, 465
SfcI CTRYAG 1 cut(s) 258
SmiMI CAYNNNNRTG 1 cut(s) 132
Sse9I AATT 5 cut(s) 203, 380, 415, 465, 531
SsiI CCGC 2 cut(s) 239, 427
SspMI CTAG 1 cut(s) 266
StyI CCWWGG 2 cut(s) 74, 374
TaaI ACNGT 1 cut(s) 84
TasI AATT 5 cut(s) 203, 380, 415, 465, 531
TfiI GAWTC 1 cut(s) 343
Tru1I TTAA 5 cut(s) 41, 245, 530, 594, 718
Tru9I TTAA 5 cut(s) 41, 245, 530, 594, 718
TscAI CASTG 1 cut(s) 149
TseI GCWGC 3 cut(s) 47, 478, 561
TspDTI ATGAA 3 cut(s) 107, 143, 528
TspGWI ACGGA 1 cut(s) 425
TspRI CASTG 1 cut(s) 149
Van91I CCANNNNNTGG 1 cut(s) 303
VneI GTGCAC 1 cut(s) 547
XapI RAATTY 4 cut(s) 203, 380, 415, 465
XceI RCATGY 3 cut(s) 289, 293, 354
XspI CTAG 1 cut(s) 266
Zsp2I ATGCAT 1 cut(s) 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.