Rmu_sc0001605.1_g000005

metalloendoproteinase 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001605.1
N/A
Physical Location & Seq
Forward (+)
14538 .. 14888
351 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 351 bp
atggcttcaaaatctagtcttaattctctcttcacactcgctttcctccttctcaccctctttactctcctctcttgtgcaaatgcagaagaaactcacaacaaaacatcgtccccagttgaattcgttgagcatctcaacgggtctctcaaaggtgaggtcaaaagcatcaatgacctccaaaaatttctcaaaaaatttggtttcttggagttgaactacaagatcctcaatcagtccaatgacgacgaggatttcgtggaggaaggcatgaagactttgaccacctcttgttactatggagctgcattgacattgttgttgtatgggttaaagattcatgatgtgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PG_binding_1 Peptidase_M10

Protein Analysis

116

Amino Acids

12.97

Weight (kDa)

5.26

Isoelectric Point (pI)

36.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 220
AcsI RAATTY 3 cut(s) 122, 185, 197
AgsI TTSAA 3 cut(s) 9, 122, 217
AluBI AGCT 1 cut(s) 305
AluI AGCT 1 cut(s) 305
Alw26I GTCTC 1 cut(s) 150
AlwI GGATC 1 cut(s) 220
ApeKI GCWGC 1 cut(s) 305
ApoI RAATTY 3 cut(s) 122, 185, 197
ArsI GACNNNNNNTTYG 4 cut(s) 144, 176, 239, 271
AsuHPI GGTGA 2 cut(s) 46, 167
BbsI GAAGAC 1 cut(s) 281
BbvI GCAGC 1 cut(s) 292
BcoDI GTCTC 1 cut(s) 150
BfaI CTAG 1 cut(s) 15
BisI GCNGC 1 cut(s) 306
BlsI GCNGC 1 cut(s) 307
BmrI ACTGGG 1 cut(s) 110
BmsI GCATC 2 cut(s) 142, 177
BmuI ACTGGG 1 cut(s) 110
BpiI GAAGAC 1 cut(s) 281
BsaI GGTCTC 1 cut(s) 150
Bse1I ACTGG 1 cut(s) 116
BseNI ACTGG 1 cut(s) 116
BseRI GAGGAG 1 cut(s) 59
BseXI GCAGC 1 cut(s) 292
BslFI GGGAC 1 cut(s) 97
BsmAI GTCTC 1 cut(s) 150
BsmFI GGGAC 1 cut(s) 97
Bso31I GGTCTC 1 cut(s) 150
Bsp143I GATC 1 cut(s) 225
BspHI TCATGA 1 cut(s) 340
BspPI GGATC 1 cut(s) 220
BspTNI GGTCTC 1 cut(s) 150
BsrI ACTGG 1 cut(s) 116
BssMI GATC 1 cut(s) 225
Bst6I CTCTTC 1 cut(s) 35
BstKTI GATC 1 cut(s) 228
BstMAI GTCTC 1 cut(s) 150
BstMBI GATC 1 cut(s) 225
BstV1I GCAGC 1 cut(s) 292
BstV2I GAAGAC 1 cut(s) 281
BstX2I RGATCY 1 cut(s) 225
BstYI RGATCY 1 cut(s) 225
CciI TCATGA 1 cut(s) 340
CviAII CATG 2 cut(s) 271, 341
CviJI RGCY 2 cut(s) 5, 305
CviKI_1 RGCY 2 cut(s) 5, 305
DpnI GATC 1 cut(s) 227
DpnII GATC 1 cut(s) 225
Eam1104I CTCTTC 1 cut(s) 35
EarI CTCTTC 1 cut(s) 35
Eco31I GGTCTC 1 cut(s) 150
EcoRI GAATTC 1 cut(s) 122
FaeI CATG 2 cut(s) 274, 344
FaiI YATR 4 cut(s) 272, 300, 327, 342
FaqI GGGAC 1 cut(s) 97
FatI CATG 2 cut(s) 270, 340
Fnu4HI GCNGC 1 cut(s) 306
Fsp4HI GCNGC 1 cut(s) 306
FspBI CTAG 1 cut(s) 15
GluI GCNGC 1 cut(s) 306
Hin1II CATG 2 cut(s) 274, 344
HinfI GANTC 1 cut(s) 337
HphI GGTGA 2 cut(s) 46, 167
Hpy188III TCNNGA 1 cut(s) 341
Hpy99I CGWCG 1 cut(s) 251
HpyAV CCTTC 2 cut(s) 59, 260
HpyCH4V TGCA 3 cut(s) 80, 86, 308
Hsp92II CATG 2 cut(s) 274, 344
Kzo9I GATC 1 cut(s) 225
LmnI GCTCC 1 cut(s) 302
LpnPI CCDG 1 cut(s) 129
Lsp1109I GCAGC 1 cut(s) 292
LweI GCATC 2 cut(s) 142, 177
MaeI CTAG 1 cut(s) 15
MaeIII GTNAC 1 cut(s) 293
MalI GATC 1 cut(s) 227
MboI GATC 1 cut(s) 225
MboII GAAGA 3 cut(s) 22, 101, 286
MflI RGATCY 1 cut(s) 225
MluCI AATT 4 cut(s) 22, 122, 185, 197
MnlI CCTC 9 cut(s) 56, 68, 80, 151, 188, 239, 244, 256, 298
MseI TTAA 2 cut(s) 21, 332
NdeII GATC 1 cut(s) 225
NlaIII CATG 2 cut(s) 274, 344
PagI TCATGA 1 cut(s) 340
PcsI WCGNNNNNNNCGW 1 cut(s) 255
PfeI GAWTC 1 cut(s) 337
PkrI GCNGC 1 cut(s) 307
PsuI RGATCY 1 cut(s) 225
SaqAI TTAA 2 cut(s) 21, 332
SatI GCNGC 1 cut(s) 306
Sau3AI GATC 1 cut(s) 225
SetI ASST 5 cut(s) 157, 162, 180, 290, 307
SfaNI GCATC 2 cut(s) 142, 177
Sse9I AATT 4 cut(s) 22, 122, 185, 197
SspMI CTAG 1 cut(s) 15
TasI AATT 4 cut(s) 22, 122, 185, 197
TfiI GAWTC 1 cut(s) 337
Tru1I TTAA 2 cut(s) 21, 332
Tru9I TTAA 2 cut(s) 21, 332
TseI GCWGC 1 cut(s) 305
TspDTI ATGAA 2 cut(s) 287, 329
XapI RAATTY 3 cut(s) 122, 185, 197
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.