Rmu_sc0001629.1_g000006

Carbohydrate-binding protein of the ER

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001629.1
N/A
Physical Location & Seq
Reverse (-)
19234 .. 19578
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001629.1_g000006.1.cds

Sequence Viewer

Length: 345 bp
atgaagtctgcatcaaacaacttctgtcaaggttttgtgattggcagtggtggatttgggaaggtctacaagggttatataggaggtgctggctacactgcaactactattgctataaagcgtgcaaattccacttcgaagcaaggcttacatgaattccaaacagaaatcaccatgctctccaagctacgacaccaccacttggtttctttgattgggtactgcaaagaagacagggaaatgatacttgtgtacgactatatggcacaaggtacactccctgatcatctttatggtaagtaccagaaacccccacttccttggaagcagaggatcaagacatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

12.82

Weight (kDa)

9.6

Isoelectric Point (pI)

25.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 202
AccI GTMKAC 1 cut(s) 66
AclWI GGATC 1 cut(s) 341
AcsI RAATTY 2 cut(s) 127, 155
AfaI GTAC 4 cut(s) 221, 254, 274, 302
AfiI CCNNNNNNNGG 1 cut(s) 202
AluBI AGCT 1 cut(s) 187
AluI AGCT 1 cut(s) 187
AlwI GGATC 1 cut(s) 341
ApoI RAATTY 2 cut(s) 127, 155
AsuHPI GGTGA 1 cut(s) 163
AsuII TTCGAA 1 cut(s) 137
BaeI ACNNNNGTAYC 2 cut(s) 236, 269
BbsI GAAGAC 1 cut(s) 237
BclI TGATCA 1 cut(s) 283
BmsI GCATC 1 cut(s) 20
BpiI GAAGAC 1 cut(s) 237
Bpu14I TTCGAA 1 cut(s) 137
BsaJI CCNNGG 1 cut(s) 320
Bsc4I CCNNNNNNNGG 1 cut(s) 202
BseDI CCNNGG 1 cut(s) 320
BseLI CCNNNNNNNGG 1 cut(s) 202
BslI CCNNNNNNNGG 1 cut(s) 202
Bsp119I TTCGAA 1 cut(s) 137
Bsp143I GATC 2 cut(s) 283, 333
BspPI GGATC 1 cut(s) 341
BspT104I TTCGAA 1 cut(s) 137
BssECI CCNNGG 1 cut(s) 320
BssMI GATC 2 cut(s) 283, 333
BssT1I CCWWGG 1 cut(s) 320
BstBI TTCGAA 1 cut(s) 137
BstC8I GCNNGC 2 cut(s) 91, 123
BstKTI GATC 2 cut(s) 286, 336
BstMBI GATC 2 cut(s) 283, 333
BstMWI GCNNNNNNNGC 1 cut(s) 184
BstV2I GAAGAC 1 cut(s) 237
BstXI CCANNNNNNTGG 1 cut(s) 321
BtsI GCAGTG 2 cut(s) 52, 96
BtsIMutI CAGTG 2 cut(s) 52, 96
Cac8I GCNNGC 2 cut(s) 91, 123
Csp6I GTAC 4 cut(s) 220, 253, 273, 301
CviAII CATG 3 cut(s) 152, 175, 342
CviJI RGCY 3 cut(s) 93, 147, 187
CviKI_1 RGCY 3 cut(s) 93, 147, 187
CviQI GTAC 4 cut(s) 220, 253, 273, 301
DpnI GATC 2 cut(s) 285, 335
DpnII GATC 2 cut(s) 283, 333
Eco130I CCWWGG 1 cut(s) 320
EcoRI GAATTC 1 cut(s) 155
EcoT14I CCWWGG 1 cut(s) 320
ErhI CCWWGG 1 cut(s) 320
FaeI CATG 3 cut(s) 155, 178, 345
FaiI YATR 9 cut(s) 78, 80, 116, 153, 176, 261, 263, 294, 343
FalI AAGNNNNNCTT 2 cut(s) 131, 163
FatI CATG 3 cut(s) 151, 174, 341
FbaI TGATCA 1 cut(s) 283
FblI GTMKAC 1 cut(s) 66
Hin1II CATG 3 cut(s) 155, 178, 345
HphI GGTGA 1 cut(s) 163
Hpy166II GTNNAC 3 cut(s) 67, 253, 275
Hpy188III TCNNGA 1 cut(s) 337
Hpy8I GTNNAC 3 cut(s) 67, 253, 275
HpyAV CCTTC 1 cut(s) 55
HpyCH4V TGCA 4 cut(s) 11, 101, 125, 225
HpyF10VI GCNNNNNNNGC 1 cut(s) 184
Hsp92II CATG 3 cut(s) 155, 178, 345
Ksp22I TGATCA 1 cut(s) 283
Kzo9I GATC 2 cut(s) 283, 333
LpnPI CCDG 4 cut(s) 75, 220, 294, 317
LweI GCATC 1 cut(s) 20
MalI GATC 2 cut(s) 285, 335
MboI GATC 2 cut(s) 283, 333
MboII GAAGA 1 cut(s) 242
MluCI AATT 2 cut(s) 127, 155
MnlI CCTC 2 cut(s) 77, 324
MslI CAYNNNNRTG 1 cut(s) 291
MwoI GCNNNNNNNGC 1 cut(s) 184
NdeII GATC 2 cut(s) 283, 333
NlaIII CATG 3 cut(s) 155, 178, 345
NspV TTCGAA 1 cut(s) 137
PflMI CCANNNNNTGG 1 cut(s) 202
RsaI GTAC 4 cut(s) 221, 254, 274, 302
RsaNI GTAC 4 cut(s) 220, 253, 273, 301
RseI CAYNNNNRTG 1 cut(s) 291
Sau3AI GATC 2 cut(s) 283, 333
SetI ASST 5 cut(s) 34, 66, 88, 189, 274
SfaNI GCATC 1 cut(s) 20
SfuI TTCGAA 1 cut(s) 137
SmiMI CAYNNNNRTG 1 cut(s) 291
Sse9I AATT 2 cut(s) 127, 155
StyI CCWWGG 1 cut(s) 320
TaqI TCGA 1 cut(s) 137
TasI AATT 2 cut(s) 127, 155
TscAI CASTG 2 cut(s) 52, 103
TspDTI ATGAA 2 cut(s) 17, 168
TspRI CASTG 2 cut(s) 52, 103
Van91I CCANNNNNTGG 1 cut(s) 202
XapI RAATTY 2 cut(s) 127, 155
XmiI GTMKAC 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.