Rmu_sc0001629.1_g000008

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001629.1
N/A
Physical Location & Seq
Forward (+)
22038 .. 23979
1942 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 522 bp
atggaaaatggaaaatgcaggacagtgagattaataaagaaagacccgggctttcgtgaagtgatccaagctgaagttaggggactgttcactggccttctgctttctcaaaaccttcatattacacgcttggaaggggcaagtgattctgctgtggctattaaccttctgatgaaggttgataatgatatgcacccttttggaaacacttgtacagaattgcagaactttggggatgtcagtcatatcactttcttgataccctcttgctcgcattgtgaagactatgatttagctggtgctgaaatctctacaggcttgggctctgtttcccatatgatccaagctgaagttaggggactgttcactggccttctgctttctcaaaaccttcatattacacgcttggaaggggcaagtgattctgctgtggctattaaccttctgatgaaggttgataatgatatgcacccttttggaaacacttgtacagaattgcagaactttggtgcagcagcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3 zf-RVT

Protein Analysis

173

Amino Acids

18.76

Weight (kDa)

5.23

Isoelectric Point (pI)

34.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 58, 334
AcuI CTGAAG 2 cut(s) 93, 369
AfaI GTAC 2 cut(s) 214, 490
AluBI AGCT 3 cut(s) 71, 296, 347
AluI AGCT 3 cut(s) 71, 296, 347
AlwI GGATC 2 cut(s) 58, 334
Ama87I CYCGRG 1 cut(s) 46
AoxI GGCC 2 cut(s) 94, 370
ApeKI GCWGC 2 cut(s) 512, 515
AseI ATTAAT 1 cut(s) 32
AsuC2I CCSGG 2 cut(s) 47, 48
AvaI CYCGRG 1 cut(s) 46
BanII GRGCYC 1 cut(s) 326
BbsI GAAGAC 1 cut(s) 288
BcnI CCSGG 2 cut(s) 47, 48
BfmI CTRYAG 1 cut(s) 312
BisI GCNGC 2 cut(s) 513, 516
BlsI GCNGC 2 cut(s) 514, 517
Bme1390I CCNGG 2 cut(s) 47, 48
BmeT110I CYCGRG 1 cut(s) 46
BmrFI CCNGG 2 cut(s) 47, 48
BpiI GAAGAC 1 cut(s) 288
BpuMI CCSGG 2 cut(s) 47, 48
BsaJI CCNNGG 1 cut(s) 46
Bse1I ACTGG 2 cut(s) 97, 373
BseDI CCNNGG 1 cut(s) 46
BseGI GGATG 1 cut(s) 241
BseNI ACTGG 2 cut(s) 97, 373
BshFI GGCC 2 cut(s) 96, 372
BsiHKCI CYCGRG 1 cut(s) 46
BsiSI CCGG 1 cut(s) 47
BslFI GGGAC 2 cut(s) 96, 372
BsmFI GGGAC 2 cut(s) 96, 372
BsnI GGCC 2 cut(s) 96, 372
BsoBI CYCGRG 1 cut(s) 46
Bsp1286I GDGCHC 1 cut(s) 326
Bsp1407I TGTACA 2 cut(s) 212, 488
Bsp143I GATC 2 cut(s) 63, 339
BspANI GGCC 2 cut(s) 96, 372
BspPI GGATC 2 cut(s) 58, 334
BsrGI TGTACA 2 cut(s) 212, 488
BsrI ACTGG 2 cut(s) 97, 373
BssECI CCNNGG 1 cut(s) 46
BssMI GATC 2 cut(s) 63, 339
Bst4CI ACNGT 3 cut(s) 25, 87, 363
BstAUI TGTACA 2 cut(s) 212, 488
BstC8I GCNNGC 1 cut(s) 272
BstF5I GGATG 1 cut(s) 241
BstKTI GATC 2 cut(s) 66, 342
BstMBI GATC 2 cut(s) 63, 339
BstSCI CCNGG 2 cut(s) 45, 46
BstSFI CTRYAG 1 cut(s) 312
BstV2I GAAGAC 1 cut(s) 288
BsuRI GGCC 2 cut(s) 96, 372
BtsCI GGATG 1 cut(s) 241
BtsIMutI CAGTG 3 cut(s) 30, 90, 366
Cac8I GCNNGC 1 cut(s) 272
Cfr9I CCCGGG 1 cut(s) 46
Csp6I GTAC 2 cut(s) 213, 489
CviAII CATG 1 cut(s) 519
CviQI GTAC 2 cut(s) 213, 489
DpnI GATC 2 cut(s) 65, 341
DpnII GATC 2 cut(s) 63, 339
Eco24I GRGCYC 1 cut(s) 326
Eco57I CTGAAG 2 cut(s) 93, 369
Eco88I CYCGRG 1 cut(s) 46
EcoT38I GRGCYC 1 cut(s) 326
FaeI CATG 1 cut(s) 522
FaiI YATR 9 cut(s) 120, 191, 246, 288, 336, 338, 396, 467, 520
FaqI GGGAC 2 cut(s) 96, 372
FatI CATG 1 cut(s) 518
FauNDI CATATG 1 cut(s) 336
Fnu4HI GCNGC 2 cut(s) 513, 516
FokI GGATG 1 cut(s) 248
FriOI GRGCYC 1 cut(s) 326
Fsp4HI GCNGC 2 cut(s) 513, 516
GluI GCNGC 2 cut(s) 513, 516
HaeIII GGCC 2 cut(s) 96, 372
HapII CCGG 1 cut(s) 47
Hin1II CATG 1 cut(s) 522
HinfI GANTC 2 cut(s) 146, 422
HpaII CCGG 1 cut(s) 47
Hpy166II GTNNAC 2 cut(s) 90, 366
Hpy188I TCNGA 2 cut(s) 171, 447
Hpy188III TCNNGA 2 cut(s) 56, 256
Hpy8I GTNNAC 2 cut(s) 90, 366
HpyCH4III ACNGT 3 cut(s) 25, 87, 363
HpyCH4V TGCA 6 cut(s) 18, 193, 223, 469, 499, 512
Hsp92II CATG 1 cut(s) 522
Kzo9I GATC 2 cut(s) 63, 339
LpnPI CCDG 6 cut(s) 4, 60, 78, 282, 300, 354
MalI GATC 2 cut(s) 65, 341
MboI GATC 2 cut(s) 63, 339
MboII GAAGA 1 cut(s) 293
MhlI GDGCHC 1 cut(s) 326
MluCI AATT 2 cut(s) 218, 494
MnlI CCTC 1 cut(s) 274
MseI TTAA 3 cut(s) 32, 162, 438
MspI CCGG 1 cut(s) 47
MspR9I CCNGG 2 cut(s) 47, 48
NciI CCSGG 2 cut(s) 47, 48
NdeI CATATG 1 cut(s) 336
NdeII GATC 2 cut(s) 63, 339
NlaIII CATG 1 cut(s) 522
PfeI GAWTC 2 cut(s) 146, 422
PkrI GCNGC 2 cut(s) 514, 517
PshBI ATTAAT 1 cut(s) 32
RsaI GTAC 2 cut(s) 214, 490
RsaNI GTAC 2 cut(s) 213, 489
SaqAI TTAA 3 cut(s) 32, 162, 438
SatI GCNGC 2 cut(s) 513, 516
Sau3AI GATC 2 cut(s) 63, 339
ScrFI CCNGG 2 cut(s) 47, 48
SduI GDGCHC 1 cut(s) 326
SetI ASST 9 cut(s) 73, 117, 168, 180, 298, 349, 393, 444, 456
SfcI CTRYAG 1 cut(s) 312
SmaI CCCGGG 1 cut(s) 48
Sse9I AATT 2 cut(s) 218, 494
StyD4I CCNGG 2 cut(s) 45, 46
TaaI ACNGT 3 cut(s) 25, 87, 363
TasI AATT 2 cut(s) 218, 494
TatI WGTACW 2 cut(s) 212, 488
TfiI GAWTC 2 cut(s) 146, 422
Tru1I TTAA 3 cut(s) 32, 162, 438
Tru9I TTAA 3 cut(s) 32, 162, 438
TscAI CASTG 3 cut(s) 30, 97, 373
TseI GCWGC 2 cut(s) 512, 515
TspDTI ATGAA 4 cut(s) 107, 188, 383, 464
TspMI CCCGGG 1 cut(s) 46
TspRI CASTG 3 cut(s) 30, 97, 373
VspI ATTAAT 1 cut(s) 32
XmaI CCCGGG 1 cut(s) 46
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.