Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001659.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

30479 .. 30907

Gene Structure 429 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 429 bp

atgtcgtctatggagatcgacaatcccaagccgatgtcgtctatggagatcgataatcccaagccaaacacctccaatcagtttggccattctccgatccattccttgggggagagaccaaaacggaaaaaggaaaccgaaaaatcccagaagacgaagatgaagatgccagaagagtacgatctagccaggtcgaacgattacgcagagtacaggagggagagaaagaagaaggcgatggaggctaaggtgaggagagagcttgatcggagaagacaggaggaagagaggatagagagggaggagagagagaatgagagagaaaccatcagagctgagagagagaggaggaggagaaaagaagaaaatatttttgaaatgacatttttagcccttcaagtgggcccctctgtcaaacttaacgtctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0008150 GO:0009507 GO:0009536 GO:0010468 GO:0019219 GO:0019222 GO:0031323 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043484 GO:0044424 GO:0044444 GO:0044464 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090

KEGG Pathways

Metabolic & Signaling

ko03040 map03040

Pfam Domains

Protein Families

G-patch RRM_1

Protein Analysis

142

Amino Acids

17.21

Weight (kDa)

9.58

Isoelectric Point (pI)

91.71

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	106
AclWI	GGATC	1 cut(s)	91
AcoI	YGGCCR	1 cut(s)	85
AfaI	GTAC	2 cut(s)	179, 212
AfiI	CCNNNNNNNGG	2 cut(s)	106, 400
AgsI	TTSAA	2 cut(s)	377, 398
AjnI	CCWGG	1 cut(s)	188
AluBI	AGCT	2 cut(s)	262, 335
AluI	AGCT	2 cut(s)	262, 335
Alw26I	GTCTC	1 cut(s)	109
AlwI	GGATC	1 cut(s)	91
AoxI	GGCC	2 cut(s)	85, 403
ApaI	GGGCCC	1 cut(s)	407
ArsI	GACNNNNNNTTYG	1 cut(s)	408
AspS9I	GGNCC	2 cut(s)	403, 404
AsuHPI	GGTGA	1 cut(s)	262
BaeGI	GKGCMC	1 cut(s)	407
BalI	TGGCCA	1 cut(s)	87
BanII	GRGCYC	1 cut(s)	407
BbsI	GAAGAC	2 cut(s)	158, 280
BccI	CCATC	2 cut(s)	232, 335
BciT130I	CCWGG	1 cut(s)	190
BcoDI	GTCTC	1 cut(s)	109
BfaI	CTAG	1 cut(s)	185
Bme1390I	CCNGG	1 cut(s)	190
BmgT120I	GGNCC	2 cut(s)	403, 404
BmiI	GGNNCC	2 cut(s)	405, 406
BmrFI	CCNGG	1 cut(s)	190
BmsI	GCATC	1 cut(s)	156
BpiI	GAAGAC	2 cut(s)	158, 280
Bpu10I	CCTNAGC	1 cut(s)	246
Bsa29I	ATCGAT	1 cut(s)	51
BsaI	GGTCTC	1 cut(s)	109
BsaJI	CCNNGG	1 cut(s)	105
Bsc4I	CCNNNNNNNGG	2 cut(s)	106, 400
BseBI	CCWGG	1 cut(s)	190
BseCI	ATCGAT	1 cut(s)	51
BseDI	CCNNGG	1 cut(s)	105
BseLI	CCNNNNNNNGG	2 cut(s)	106, 400
BseMII	CTCAG	1 cut(s)	327
BseRI	GAGGAG	5 cut(s)	268, 317, 361, 364, 367
BseSI	GKGCMC	1 cut(s)	407
BshFI	GGCC	2 cut(s)	87, 405
BshVI	ATCGAT	1 cut(s)	51
BslI	CCNNNNNNNGG	2 cut(s)	106, 400
BsmAI	GTCTC	1 cut(s)	109
BsnI	GGCC	2 cut(s)	87, 405
Bso31I	GGTCTC	1 cut(s)	109
Bsp120I	GGGCCC	1 cut(s)	403
Bsp1286I	GDGCHC	1 cut(s)	407
Bsp143I	GATC	5 cut(s)	15, 48, 96, 181, 265
BspANI	GGCC	2 cut(s)	87, 405
BspCNI	CTCAG	1 cut(s)	328
BspDI	ATCGAT	1 cut(s)	51
BspLI	GGNNCC	2 cut(s)	405, 406
BspPI	GGATC	1 cut(s)	91
BspTNI	GGTCTC	1 cut(s)	109
BssECI	CCNNGG	1 cut(s)	105
BssMI	GATC	5 cut(s)	15, 48, 96, 181, 265
BssT1I	CCWWGG	1 cut(s)	105
Bst2UI	CCWGG	1 cut(s)	190
Bst6I	CTCTTC	2 cut(s)	168, 279
BstDEI	CTNAG	2 cut(s)	246, 336
BstKTI	GATC	5 cut(s)	18, 51, 99, 184, 268
BstMAI	GTCTC	1 cut(s)	109
BstMBI	GATC	5 cut(s)	15, 48, 96, 181, 265
BstMWI	GCNNNNNNNGC	1 cut(s)	242
BstNI	CCWGG	1 cut(s)	190
BstSCI	CCNGG	1 cut(s)	188
BstSLI	GKGCMC	1 cut(s)	407
BstV2I	GAAGAC	2 cut(s)	158, 280
Bsu15I	ATCGAT	1 cut(s)	51
BsuRI	GGCC	2 cut(s)	87, 405
BsuTUI	ATCGAT	1 cut(s)	51
BtgZI	GCGATG	1 cut(s)	251
Cfr13I	GGNCC	2 cut(s)	403, 404
ClaI	ATCGAT	1 cut(s)	51
Csp6I	GTAC	2 cut(s)	178, 211
CviJI	RGCY	9 cut(s)	31, 64, 87, 188, 245, 262, 335, 392, 405
CviKI_1	RGCY	9 cut(s)	31, 64, 87, 188, 245, 262, 335, 392, 405
CviQI	GTAC	2 cut(s)	178, 211
DdeI	CTNAG	2 cut(s)	246, 336
DpnI	GATC	5 cut(s)	17, 50, 98, 183, 267
DpnII	GATC	5 cut(s)	15, 48, 96, 181, 265
EaeI	YGGCCR	1 cut(s)	85
Eam1104I	CTCTTC	2 cut(s)	168, 279
EarI	CTCTTC	2 cut(s)	168, 279
Eco130I	CCWWGG	1 cut(s)	105
Eco24I	GRGCYC	1 cut(s)	407
Eco31I	GGTCTC	1 cut(s)	109
EcoO109I	RGGNCCY	1 cut(s)	404
EcoRII	CCWGG	1 cut(s)	188
EcoT14I	CCWWGG	1 cut(s)	105
EcoT38I	GRGCYC	1 cut(s)	407
ErhI	CCWWGG	1 cut(s)	105
FaiI	YATR	2 cut(s)	11, 44
FriOI	GRGCYC	1 cut(s)	407
FspBI	CTAG	1 cut(s)	185
HaeIII	GGCC	2 cut(s)	87, 405
HphI	GGTGA	1 cut(s)	262
Hpy188I	TCNGA	4 cut(s)	96, 270, 332, 428
HpyAV	CCTTC	2 cut(s)	226, 404
HpyCH4IV	ACGT	1 cut(s)	423
HpyF10VI	GCNNNNNNNGC	1 cut(s)	242
HpyF3I	CTNAG	2 cut(s)	246, 336
HpySE526I	ACGT	1 cut(s)	423
Kzo9I	GATC	5 cut(s)	15, 48, 96, 181, 265
LpnPI	CCDG	6 cut(s)	161, 175, 183, 199, 202, 263
LweI	GCATC	1 cut(s)	156
MaeI	CTAG	1 cut(s)	185
MaeII	ACGT	1 cut(s)	423
MalI	GATC	5 cut(s)	17, 50, 98, 183, 267
MboI	GATC	5 cut(s)	15, 48, 96, 181, 265
MboII	GAAGA	8 cut(s)	163, 169, 175, 185, 241, 285, 296, 374
MhlI	GDGCHC	1 cut(s)	407
MlsI	TGGCCA	1 cut(s)	87
MluNI	TGGCCA	1 cut(s)	87
Mox20I	TGGCCA	1 cut(s)	87
MscI	TGGCCA	1 cut(s)	87
MseI	TTAA	1 cut(s)	420
Msp20I	TGGCCA	1 cut(s)	87
MspR9I	CCNGG	1 cut(s)	190
MvaI	CCWGG	1 cut(s)	190
MwoI	GCNNNNNNNGC	1 cut(s)	242
NdeII	GATC	5 cut(s)	15, 48, 96, 181, 265
NlaIV	GGNNCC	2 cut(s)	405, 406
PflMI	CCANNNNNTGG	1 cut(s)	106
Psp6I	CCWGG	1 cut(s)	188
PspGI	CCWGG	1 cut(s)	188
PspN4I	GGNNCC	2 cut(s)	405, 406
PspOMI	GGGCCC	1 cut(s)	403
PspPI	GGNCC	2 cut(s)	403, 404
RsaI	GTAC	2 cut(s)	179, 212
RsaNI	GTAC	2 cut(s)	178, 211
SaqAI	TTAA	1 cut(s)	420
Sau3AI	GATC	5 cut(s)	15, 48, 96, 181, 265
Sau96I	GGNCC	2 cut(s)	403, 404
ScrFI	CCNGG	1 cut(s)	190
SduI	GDGCHC	1 cut(s)	407
SetI	ASST	6 cut(s)	74, 194, 252, 264, 337, 426
SfaNI	GCATC	1 cut(s)	156
SspI	AATATT	1 cut(s)	370
SspMI	CTAG	1 cut(s)	185
StyD4I	CCNGG	1 cut(s)	188
StyI	CCWWGG	1 cut(s)	105
TaiI	ACGT	1 cut(s)	426
TaqI	TCGA	3 cut(s)	18, 51, 194
TatI	WGTACW	1 cut(s)	210
Tru1I	TTAA	1 cut(s)	420
Tru9I	TTAA	1 cut(s)	420
TspDTI	ATGAA	1 cut(s)	176
TspGWI	ACGGA	1 cut(s)	139
Van91I	CCANNNNNTGG	1 cut(s)	106
XspI	CTAG	1 cut(s)	185

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.