Rmu_sc0001694.1_g000013

ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001694.1
N/A
Physical Location & Seq
Reverse (-)
87792 .. 88157
366 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 366 bp
atgggcgatttcaatgaaatccttctttcgtctgagaaattgggtagcaaacctaggtcagaaactcaaatgcaaggatttcgggaccccctacactacacagaattgattgatttggggtactttggcgtgccttttacttggagcgatccggtaactaaggtgcgcttggatagagtaacggccacgcaaacttggttggacatttttctacatttaagggtacggtatcttcctctaagcacttctgatcatgttcctctattgattcaagtaagtgtcaatcctattgttccaaagcagtggtttcgtcgctttcgttttgagagcttttggcttcagcaagatacatgtaatacggcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-CCHC_4 zf-RVT

Protein Analysis

121

Amino Acids

14.23

Weight (kDa)

6.82

Isoelectric Point (pI)

38.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 143
AcoI YGGCCR 1 cut(s) 183
AcuI CTGAAG 1 cut(s) 323
AfaI GTAC 2 cut(s) 122, 225
AflIII ACRYGT 1 cut(s) 350
AgsI TTSAA 2 cut(s) 13, 272
AluBI AGCT 1 cut(s) 330
AluI AGCT 1 cut(s) 330
AlwI GGATC 1 cut(s) 143
AoxI GGCC 1 cut(s) 183
Asp700I GAANNNNTTC 1 cut(s) 21
AspA2I CCTAGG 1 cut(s) 53
AspLEI GCGC 1 cut(s) 168
AspS9I GGNCC 1 cut(s) 85
AvaII GGWCC 1 cut(s) 85
AvrII CCTAGG 1 cut(s) 53
BarI GAAGNNNNNNTAC 2 cut(s) 216, 248
BceAI ACGGC 1 cut(s) 198
BcgI CGANNNNNNTGC 4 cut(s) 62, 96, 290, 324
BclI TGATCA 1 cut(s) 250
BfaI CTAG 1 cut(s) 54
BlnI CCTAGG 1 cut(s) 53
Bme18I GGWCC 1 cut(s) 85
BmgT120I GGNCC 1 cut(s) 85
BmiI GGNNCC 2 cut(s) 86, 87
BsaJI CCNNGG 1 cut(s) 53
BsaWI WCCGGW 1 cut(s) 151
BseDI CCNNGG 1 cut(s) 53
BseMII CTCAG 1 cut(s) 24
BshFI GGCC 1 cut(s) 185
BsiSI CCGG 1 cut(s) 152
BslFI GGGAC 1 cut(s) 98
BsmFI GGGAC 1 cut(s) 98
BsnI GGCC 1 cut(s) 185
Bsp143I GATC 2 cut(s) 148, 250
BspANI GGCC 1 cut(s) 185
BspCNI CTCAG 1 cut(s) 25
BspLI GGNNCC 2 cut(s) 86, 87
BspPI GGATC 1 cut(s) 143
BssECI CCNNGG 1 cut(s) 53
BssMI GATC 2 cut(s) 148, 250
BssT1I CCWWGG 1 cut(s) 53
Bst4CI ACNGT 1 cut(s) 228
BstC8I GCNNGC 1 cut(s) 131
BstDEI CTNAG 3 cut(s) 33, 159, 239
BstHHI GCGC 1 cut(s) 168
BstKTI GATC 2 cut(s) 151, 253
BstMBI GATC 2 cut(s) 148, 250
BstNSI RCATGY 1 cut(s) 354
BstXI CCANNNNNNTGG 1 cut(s) 303
BsuRI GGCC 1 cut(s) 185
BtsI GCAGTG 1 cut(s) 308
BtsIMutI CAGTG 1 cut(s) 308
Cac8I GCNNGC 1 cut(s) 131
CfoI GCGC 1 cut(s) 168
Cfr13I GGNCC 1 cut(s) 85
Csp6I GTAC 2 cut(s) 121, 224
CviAII CATG 3 cut(s) 254, 351, 363
CviJI RGCY 3 cut(s) 185, 330, 337
CviKI_1 RGCY 3 cut(s) 185, 330, 337
CviQI GTAC 2 cut(s) 121, 224
DdeI CTNAG 3 cut(s) 33, 159, 239
DpnI GATC 2 cut(s) 150, 252
DpnII GATC 2 cut(s) 148, 250
EaeI YGGCCR 1 cut(s) 183
Eco130I CCWWGG 1 cut(s) 53
Eco47I GGWCC 1 cut(s) 85
Eco57I CTGAAG 1 cut(s) 323
EcoO109I RGGNCCY 1 cut(s) 85
EcoT14I CCWWGG 1 cut(s) 53
ErhI CCWWGG 1 cut(s) 53
FaeI CATG 3 cut(s) 257, 354, 366
FaiI YATR 3 cut(s) 255, 352, 364
FalI AAGNNNNNCTT 2 cut(s) 152, 184
FaqI GGGAC 1 cut(s) 98
FatI CATG 3 cut(s) 253, 350, 362
FbaI TGATCA 1 cut(s) 250
FspBI CTAG 1 cut(s) 54
GlaI GCGC 1 cut(s) 167
HaeIII GGCC 1 cut(s) 185
HapII CCGG 1 cut(s) 152
HhaI GCGC 1 cut(s) 168
Hin1II CATG 3 cut(s) 257, 354, 366
Hin6I GCGC 1 cut(s) 166
HinP1I GCGC 1 cut(s) 166
HinfI GANTC 1 cut(s) 268
HpaII CCGG 1 cut(s) 152
Hpy188I TCNGA 3 cut(s) 34, 61, 250
Hpy188III TCNNGA 1 cut(s) 83
Hpy99I CGWCG 1 cut(s) 315
HpyAV CCTTC 1 cut(s) 32
HpyCH4III ACNGT 1 cut(s) 228
HpyCH4V TGCA 1 cut(s) 73
HpyF3I CTNAG 3 cut(s) 33, 159, 239
Hsp92II CATG 3 cut(s) 257, 354, 366
HspAI GCGC 1 cut(s) 166
KflI GGGWCCC 1 cut(s) 85
Ksp22I TGATCA 1 cut(s) 250
Kzo9I GATC 2 cut(s) 148, 250
LmnI GCTCC 1 cut(s) 144
LpnPI CCDG 1 cut(s) 165
MaeI CTAG 1 cut(s) 54
MaeIII GTNAC 2 cut(s) 154, 178
MalI GATC 2 cut(s) 150, 252
MboI GATC 2 cut(s) 148, 250
MboII GAAGA 1 cut(s) 224
MluCI AATT 2 cut(s) 38, 104
MmeI TCCRAC 1 cut(s) 180
MnlI CCTC 2 cut(s) 246, 270
MroXI GAANNNNTTC 1 cut(s) 21
MseI TTAA 1 cut(s) 218
MspI CCGG 1 cut(s) 152
NdeII GATC 2 cut(s) 148, 250
NlaIII CATG 3 cut(s) 257, 354, 366
NlaIV GGNNCC 2 cut(s) 86, 87
NspI RCATGY 1 cut(s) 354
PciI ACATGT 1 cut(s) 350
PcsI WCGNNNNNNNCGW 1 cut(s) 316
PdmI GAANNNNTTC 1 cut(s) 21
PfeI GAWTC 1 cut(s) 268
PpuMI RGGWCCY 1 cut(s) 85
PscI ACATGT 1 cut(s) 350
Psp5II RGGWCCY 1 cut(s) 85
PspN4I GGNNCC 2 cut(s) 86, 87
PspPI GGNCC 1 cut(s) 85
PspPPI RGGWCCY 1 cut(s) 85
RsaI GTAC 2 cut(s) 122, 225
RsaNI GTAC 2 cut(s) 121, 224
SaqAI TTAA 1 cut(s) 218
Sau3AI GATC 2 cut(s) 148, 250
Sau96I GGNCC 1 cut(s) 85
SetI ASST 4 cut(s) 55, 59, 165, 332
SinI GGWCC 1 cut(s) 85
Sse9I AATT 2 cut(s) 38, 104
SspMI CTAG 1 cut(s) 54
StyI CCWWGG 1 cut(s) 53
TaaI ACNGT 1 cut(s) 228
TasI AATT 2 cut(s) 38, 104
TfiI GAWTC 1 cut(s) 268
Tru1I TTAA 1 cut(s) 218
Tru9I TTAA 1 cut(s) 218
TscAI CASTG 1 cut(s) 308
TspDTI ATGAA 1 cut(s) 30
TspRI CASTG 1 cut(s) 308
VpaK11BI GGWCC 1 cut(s) 85
XceI RCATGY 1 cut(s) 354
XmaJI CCTAGG 1 cut(s) 53
XmnI GAANNNNTTC 1 cut(s) 21
XspI CTAG 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.