Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001694.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

120179 .. 121167

Gene Structure 989 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 621 bp

atgacagttcgtgaaacattggacttctctggacgttgccttggagttggaaccaggtacgatatgctggtagagttgtctagaagggagaaagattcgggtatcaaaccagatgctgagattgatgcattcatgaaagccacatccatgtcaggccaggaaactagtttgatcacagattacgttctcaagatacttgggttagatatctgtgctgatataatggtgggagatgacatgaggagaggaatatctggtggacagaagaaacgtgtaactactggagaaatgttggttggaccagcgaaagcatttttcatggacgaaatatcaacggggctggacggagagcagaatccgccgttatatcggcggaggctatggctatggctgagacacgacttctttggcgtgacctccatgcccgacttttccagtttggtgtgtaactcttttatgtcatattgcattgaaagcccattgatgattatgagaaatgttggttggaccagcgaaagcatttttcatggacgaaatatcaacggggctggacagttccacgaccttccagattgtcaaattcatgaggcagatggttcatattatgctttttttaggtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005215 GO:0005575 GO:0005623 GO:0005886 GO:0006810 GO:0008150 GO:0015399 GO:0015405 GO:0016020 GO:0016021 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0016887 GO:0017111 GO:0022804 GO:0022857 GO:0031224 GO:0042623 GO:0042626 GO:0043492 GO:0044425 GO:0044464 GO:0051179 GO:0051234 GO:0055085 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ABC2_membrane ABC_tran ABC_trans_N PDR_assoc

Protein Analysis

206

Amino Acids

23.23

Weight (kDa)

5.23

Isoelectric Point (pI)

45.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	359, 373
AcsI	RAATTY	1 cut(s)	579
AfaI	GTAC	1 cut(s)	59
AflIII	ACRYGT	1 cut(s)	271
AgsI	TTSAA	1 cut(s)	473
AhlI	ACTAGT	1 cut(s)	164
AjnI	CCWGG	2 cut(s)	53, 156
AjuI	GAANNNNNNNTTGG	4 cut(s)	279, 311, 487, 519
Alw26I	GTCTC	1 cut(s)	388
AlwNI	CAGNNNCTG	1 cut(s)	116
AoxI	GGCC	1 cut(s)	154
ApoI	RAATTY	1 cut(s)	579
AspS9I	GGNCC	2 cut(s)	299, 507
AvaII	GGWCC	2 cut(s)	299, 507
BaeI	ACNNNNGTAYC	2 cut(s)	185, 218
BccI	CCATC	1 cut(s)	587
BceAI	ACGGC	1 cut(s)	346
BciT130I	CCWGG	2 cut(s)	55, 158
BclI	TGATCA	1 cut(s)	171
BcoDI	GTCTC	1 cut(s)	388
BcuI	ACTAGT	1 cut(s)	164
BfaI	CTAG	2 cut(s)	81, 165
Bme1390I	CCNGG	2 cut(s)	55, 158
Bme18I	GGWCC	2 cut(s)	299, 507
BmgT120I	GGNCC	2 cut(s)	299, 507
BmiI	GGNNCC	1 cut(s)	52
BmrFI	CCNGG	2 cut(s)	55, 158
BmsI	GCATC	2 cut(s)	103, 115
BpmI	CTGGAG	1 cut(s)	303
BpuEI	CTTGAG	1 cut(s)	173
BsaJI	CCNNGG	1 cut(s)	40
Bse1I	ACTGG	2 cut(s)	286, 435
BseBI	CCWGG	2 cut(s)	55, 158
BseDI	CCNNGG	1 cut(s)	40
BseGI	GGATG	1 cut(s)	143
BseMII	CTCAG	2 cut(s)	108, 383
BseNI	ACTGG	2 cut(s)	286, 435
BseRI	GAGGAG	1 cut(s)	256
BshFI	GGCC	1 cut(s)	156
BsmAI	GTCTC	1 cut(s)	388
BsmI	GAATGC	1 cut(s)	128
BsnI	GGCC	1 cut(s)	156
Bsp143I	GATC	1 cut(s)	171
BspACI	CCGC	2 cut(s)	359, 373
BspANI	GGCC	1 cut(s)	156
BspCNI	CTCAG	2 cut(s)	109, 384
BspHI	TCATGA	2 cut(s)	132, 583
BspLI	GGNNCC	1 cut(s)	52
BsrI	ACTGG	2 cut(s)	286, 435
BssECI	CCNNGG	1 cut(s)	40
BssMI	GATC	1 cut(s)	171
BssT1I	CCWWGG	1 cut(s)	40
Bst2UI	CCWGG	2 cut(s)	55, 158
Bst4CI	ACNGT	2 cut(s)	7, 555
BstDEI	CTNAG	2 cut(s)	117, 392
BstF5I	GGATG	1 cut(s)	143
BstKTI	GATC	1 cut(s)	174
BstMAI	GTCTC	1 cut(s)	388
BstMBI	GATC	1 cut(s)	171
BstMWI	GCNNNNNNNGC	2 cut(s)	358, 474
BstNI	CCWGG	2 cut(s)	55, 158
BstSCI	CCNGG	2 cut(s)	53, 156
BsuRI	GGCC	1 cut(s)	156
BtsCI	GGATG	1 cut(s)	143
CaiI	CAGNNNCTG	1 cut(s)	116
CciI	TCATGA	2 cut(s)	132, 583
Cfr13I	GGNCC	2 cut(s)	299, 507
CsiI	ACCWGGT	1 cut(s)	53
Csp6I	GTAC	1 cut(s)	58
CviAII	CATG	7 cut(s)	133, 148, 238, 319, 421, 527, 584
CviJI	RGCY	8 cut(s)	140, 156, 340, 379, 385, 391, 477, 548
CviKI_1	RGCY	8 cut(s)	140, 156, 340, 379, 385, 391, 477, 548
CviQI	GTAC	1 cut(s)	58
DdeI	CTNAG	2 cut(s)	117, 392
DpnI	GATC	1 cut(s)	173
DpnII	GATC	1 cut(s)	171
EciI	GGCGGA	2 cut(s)	348, 388
Eco130I	CCWWGG	1 cut(s)	40
Eco32I	GATATC	1 cut(s)	208
Eco47I	GGWCC	2 cut(s)	299, 507
EcoRII	CCWGG	2 cut(s)	53, 156
EcoRV	GATATC	1 cut(s)	208
EcoT14I	CCWWGG	1 cut(s)	40
EcoT22I	ATGCAT	1 cut(s)	130
ErhI	CCWWGG	1 cut(s)	40
FaeI	CATG	7 cut(s)	136, 151, 241, 322, 424, 530, 587
FatI	CATG	7 cut(s)	132, 147, 237, 318, 420, 526, 583
FbaI	TGATCA	1 cut(s)	171
FokI	GGATG	1 cut(s)	130
FspBI	CTAG	2 cut(s)	81, 165
GsuI	CTGGAG	1 cut(s)	303
HaeIII	GGCC	1 cut(s)	156
Hin1II	CATG	7 cut(s)	136, 151, 241, 322, 424, 530, 587
HinfI	GANTC	2 cut(s)	95, 355
Hpy166II	GTNNAC	1 cut(s)	260
Hpy188III	TCNNGA	7 cut(s)	11, 30, 81, 133, 190, 569, 584
Hpy8I	GTNNAC	1 cut(s)	260
HpyAV	CCTTC	2 cut(s)	78, 575
HpyCH4III	ACNGT	2 cut(s)	7, 555
HpyCH4IV	ACGT	3 cut(s)	34, 183, 271
HpyCH4V	TGCA	2 cut(s)	128, 468
HpyF10VI	GCNNNNNNNGC	2 cut(s)	358, 474
HpyF3I	CTNAG	2 cut(s)	117, 392
HpySE526I	ACGT	3 cut(s)	34, 183, 271
Hsp92II	CATG	7 cut(s)	136, 151, 241, 322, 424, 530, 587
Ksp22I	TGATCA	1 cut(s)	171
Kzo9I	GATC	1 cut(s)	171
LweI	GCATC	2 cut(s)	103, 115
MabI	ACCWGGT	1 cut(s)	53
MaeI	CTAG	2 cut(s)	81, 165
MaeII	ACGT	3 cut(s)	34, 183, 271
MaeIII	GTNAC	3 cut(s)	274, 412, 446
MalI	GATC	1 cut(s)	173
MboI	GATC	1 cut(s)	171
MboII	GAAGA	1 cut(s)	277
MluCI	AATT	1 cut(s)	579
MmeI	TCCRAC	3 cut(s)	28, 277, 485
MnlI	CCTC	5 cut(s)	234, 239, 369, 427, 580
Mph1103I	ATGCAT	1 cut(s)	130
MslI	CAYNNNNRTG	1 cut(s)	146
MspR9I	CCNGG	2 cut(s)	55, 158
Mva1269I	GAATGC	1 cut(s)	128
MvaI	CCWGG	2 cut(s)	55, 158
MwoI	GCNNNNNNNGC	2 cut(s)	358, 474
NdeII	GATC	1 cut(s)	171
NlaIII	CATG	7 cut(s)	136, 151, 241, 322, 424, 530, 587
NlaIV	GGNNCC	1 cut(s)	52
NmuCI	GTSAC	1 cut(s)	412
NsiI	ATGCAT	1 cut(s)	130
PagI	TCATGA	2 cut(s)	132, 583
PctI	GAATGC	1 cut(s)	128
PfeI	GAWTC	2 cut(s)	95, 355
Psp6I	CCWGG	2 cut(s)	53, 156
PspGI	CCWGG	2 cut(s)	53, 156
PspN4I	GGNNCC	1 cut(s)	52
PspPI	GGNCC	2 cut(s)	299, 507
PstNI	CAGNNNCTG	1 cut(s)	116
RsaI	GTAC	1 cut(s)	59
RsaNI	GTAC	1 cut(s)	58
RseI	CAYNNNNRTG	1 cut(s)	146
Sau3AI	GATC	1 cut(s)	171
Sau96I	GGNCC	2 cut(s)	299, 507
ScrFI	CCNGG	2 cut(s)	55, 158
SetI	ASST	7 cut(s)	37, 59, 186, 274, 419, 567, 620
SexAI	ACCWGGT	1 cut(s)	53
SfaNI	GCATC	2 cut(s)	103, 115
SinI	GGWCC	2 cut(s)	299, 507
SmiMI	CAYNNNNRTG	1 cut(s)	146
SmlI	CTYRAG	1 cut(s)	188
SmoI	CTYRAG	1 cut(s)	188
SpeI	ACTAGT	1 cut(s)	164
Sse9I	AATT	1 cut(s)	579
SsiI	CCGC	2 cut(s)	359, 373
SspMI	CTAG	2 cut(s)	81, 165
StyD4I	CCNGG	2 cut(s)	53, 156
StyI	CCWWGG	1 cut(s)	40
TaaI	ACNGT	2 cut(s)	7, 555
TaiI	ACGT	3 cut(s)	37, 186, 274
TasI	AATT	1 cut(s)	579
TfiI	GAWTC	2 cut(s)	95, 355
TseFI	GTSAC	1 cut(s)	412
Tsp45I	GTSAC	1 cut(s)	412
TspDTI	ATGAA	6 cut(s)	121, 149, 307, 515, 572, 588
TspGWI	ACGGA	1 cut(s)	360
VpaK11BI	GGWCC	2 cut(s)	299, 507
XapI	RAATTY	1 cut(s)	579
XbaI	TCTAGA	1 cut(s)	80
XspI	CTAG	2 cut(s)	81, 165
Zsp2I	ATGCAT	1 cut(s)	130

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.