Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001725.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

47719 .. 48032

Gene Structure 314 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 219 bp

atgtcagcatcgccgtcaacaatggagtctaatggttcttcttcgacaacacgccaaaatgtgacgccggactctttccctcccatcgtctttgccggcgaggctcagagtttaaaggaggatctcaccaaggcgtccatgggaaacacgtttctccttcaaggtggggattgtgtggagatcgagcttcaaggagttcaatgccaacaacatgtgtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko00400 ko01100 ko01110 ko01130 ko01230 ko02024 map00400 map01100 map01110 map01130 map01230 map02024

Pfam Domains

Protein Families

DAHP_synth_2

Protein Analysis

72

Amino Acids

7.62

Weight (kDa)

4.33

Isoelectric Point (pI)

62.96

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DAHP_synth_2	PF01474	24 - 60	2.7e-10	Class-II DAHP synthetase family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	129
AcyI	GRCGYC	2 cut(s)	65, 134
AflIII	ACRYGT	2 cut(s)	147, 211
AgsI	TTSAA	3 cut(s)	161, 191, 200
AluBI	AGCT	1 cut(s)	187
AluI	AGCT	1 cut(s)	187
AlwI	GGATC	1 cut(s)	129
AsuHPI	GGTGA	1 cut(s)	118
BccI	CCATC	1 cut(s)	92
BglI	GCCNNNNNGGC	1 cut(s)	101
BmsI	GCATC	1 cut(s)	17
BsaHI	GRCGYC	2 cut(s)	65, 134
BsaJI	CCNNGG	2 cut(s)	129, 138
Bse118I	RCCGGY	1 cut(s)	95
BseDI	CCNNGG	2 cut(s)	129, 138
BseMII	CTCAG	1 cut(s)	119
BsiSI	CCGG	2 cut(s)	68, 96
Bsp143I	GATC	2 cut(s)	121, 180
Bsp19I	CCATGG	1 cut(s)	138
BspCNI	CTCAG	1 cut(s)	118
BspPI	GGATC	1 cut(s)	129
BsrFI	RCCGGY	1 cut(s)	95
BssAI	RCCGGY	1 cut(s)	95
BssECI	CCNNGG	2 cut(s)	129, 138
BssMI	GATC	2 cut(s)	121, 180
BssNI	GRCGYC	2 cut(s)	65, 134
BssT1I	CCWWGG	2 cut(s)	129, 138
BstACI	GRCGYC	2 cut(s)	65, 134
BstC8I	GCNNGC	1 cut(s)	97
BstDEI	CTNAG	1 cut(s)	105
BstDSI	CCRYGG	1 cut(s)	138
BstKTI	GATC	2 cut(s)	124, 183
BstMBI	GATC	2 cut(s)	121, 180
BstMWI	GCNNNNNNNGC	1 cut(s)	101
BstNSI	RCATGY	1 cut(s)	215
BstX2I	RGATCY	1 cut(s)	121
BstYI	RGATCY	1 cut(s)	121
BtgI	CCRYGG	1 cut(s)	138
Cac8I	GCNNGC	1 cut(s)	97
Cfr10I	RCCGGY	1 cut(s)	95
CseI	GACGC	2 cut(s)	73, 123
CviAII	CATG	2 cut(s)	139, 212
CviJI	RGCY	2 cut(s)	104, 187
CviKI_1	RGCY	2 cut(s)	104, 187
DdeI	CTNAG	1 cut(s)	105
DpnI	GATC	2 cut(s)	123, 182
DpnII	GATC	2 cut(s)	121, 180
DraI	TTTAAA	1 cut(s)	114
Eco130I	CCWWGG	2 cut(s)	129, 138
EcoT14I	CCWWGG	2 cut(s)	129, 138
ErhI	CCWWGG	2 cut(s)	129, 138
FaeI	CATG	2 cut(s)	142, 215
FaiI	YATR	2 cut(s)	140, 213
FatI	CATG	2 cut(s)	138, 211
HapII	CCGG	2 cut(s)	68, 96
HgaI	GACGC	2 cut(s)	73, 123
Hin1I	GRCGYC	2 cut(s)	65, 134
Hin1II	CATG	2 cut(s)	142, 215
HincII	GTYRAC	1 cut(s)	18
HindII	GTYRAC	1 cut(s)	18
HinfI	GANTC	2 cut(s)	26, 71
HpaII	CCGG	2 cut(s)	68, 96
HphI	GGTGA	1 cut(s)	118
Hpy166II	GTNNAC	1 cut(s)	18
Hpy188I	TCNGA	1 cut(s)	108
Hpy8I	GTNNAC	1 cut(s)	18
HpyAV	CCTTC	1 cut(s)	167
HpyCH4IV	ACGT	1 cut(s)	149
HpyF10VI	GCNNNNNNNGC	1 cut(s)	101
HpyF3I	CTNAG	1 cut(s)	105
HpySE526I	ACGT	1 cut(s)	149
Hsp92I	GRCGYC	2 cut(s)	65, 134
Hsp92II	CATG	2 cut(s)	142, 215
KroI	GCCGGC	1 cut(s)	95
KroNI	GCCGGC	1 cut(s)	97
Kzo9I	GATC	2 cut(s)	121, 180
LpnPI	CCDG	2 cut(s)	81, 109
LweI	GCATC	1 cut(s)	17
MaeII	ACGT	1 cut(s)	149
MaeIII	GTNAC	1 cut(s)	61
MalI	GATC	2 cut(s)	123, 182
MboI	GATC	2 cut(s)	121, 180
MboII	GAAGA	2 cut(s)	30, 33
MflI	RGATCY	1 cut(s)	121
MlyI	GAGTC	2 cut(s)	35, 65
MnlI	CCTC	3 cut(s)	90, 94, 112
MroNI	GCCGGC	1 cut(s)	95
MseI	TTAA	1 cut(s)	113
MspI	CCGG	2 cut(s)	68, 96
MwoI	GCNNNNNNNGC	1 cut(s)	101
NaeI	GCCGGC	1 cut(s)	97
NcoI	CCATGG	1 cut(s)	138
NdeII	GATC	2 cut(s)	121, 180
NgoMIV	GCCGGC	1 cut(s)	95
NlaIII	CATG	2 cut(s)	142, 215
NmuCI	GTSAC	1 cut(s)	61
NspI	RCATGY	1 cut(s)	215
PciI	ACATGT	1 cut(s)	211
PdiI	GCCGGC	1 cut(s)	97
PleI	GAGTC	2 cut(s)	34, 65
PpsI	GAGTC	2 cut(s)	34, 65
PscI	ACATGT	1 cut(s)	211
PsuI	RGATCY	1 cut(s)	121
SaqAI	TTAA	1 cut(s)	113
Sau3AI	GATC	2 cut(s)	121, 180
SchI	GAGTC	2 cut(s)	35, 65
SetI	ASST	3 cut(s)	152, 166, 189
SfaNI	GCATC	1 cut(s)	17
StyI	CCWWGG	2 cut(s)	129, 138
TaiI	ACGT	1 cut(s)	152
TaqI	TCGA	2 cut(s)	44, 183
Tru1I	TTAA	1 cut(s)	113
Tru9I	TTAA	1 cut(s)	113
TseFI	GTSAC	1 cut(s)	61
Tsp45I	GTSAC	1 cut(s)	61
XceI	RCATGY	1 cut(s)	215
XcmI	CCANNNNNNNNNTGG	1 cut(s)	136

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.