Rmu_sc0001738.1_g000039

Belongs to the peptidase M16 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001738.1
N/A
Physical Location & Seq
Forward (+)
180507 .. 181987
1481 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 384 bp
atgttttcagagaaacttgataaaattcaaggccttgtagaggacaagtttaaggaaattcgaaacattgaccgaagttgccttcgttttactggtgagccttgcacatcagaacatctggagattcttgtcagaaccgtcccaataaaagagggtcataaattgagacttgcatggcctataactccagaaattcaccattacaaggaagggccatgtaggtatcttggtcatcttatcggccatgaaggagaaggatctttatattacatcttgaaaacattgggatgggcaacaggtttgttggctggtgaatcagtttctactttggacttttctttctttgaaatagatattgatctcaccgatgcaggccagggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko05010 map05010
Pfam Domains
Protein Families
Peptidase_M16 Peptidase_M16_C Peptidase_M16_M

Protein Analysis

127

Amino Acids

14.39

Weight (kDa)

5.46

Isoelectric Point (pI)

41.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_M16_C PF05193 5 - 123 3.3e-12 Peptidase M16 inactive domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 265
AcoI YGGCCR 1 cut(s) 241
AcsI RAATTY 3 cut(s) 24, 57, 192
AfiI CCNNNNNNNGG 2 cut(s) 40, 205
AgsI TTSAA 3 cut(s) 29, 277, 347
AjnI CCWGG 1 cut(s) 375
Alw26I GTCTC 1 cut(s) 160
AlwI GGATC 1 cut(s) 265
AoxI GGCC 5 cut(s) 31, 176, 212, 241, 373
ApoI RAATTY 3 cut(s) 24, 57, 192
AspS9I GGNCC 1 cut(s) 212
AsuHPI GGTGA 4 cut(s) 107, 188, 323, 355
AsuII TTCGAA 1 cut(s) 61
BccI CCATC 1 cut(s) 282
BciT130I CCWGG 1 cut(s) 377
BcoDI GTCTC 1 cut(s) 160
Bme1390I CCNGG 1 cut(s) 377
BmgT120I GGNCC 1 cut(s) 212
BmrFI CCNGG 1 cut(s) 377
BmsI GCATC 1 cut(s) 358
BpmI CTGGAG 2 cut(s) 140, 171
Bpu14I TTCGAA 1 cut(s) 61
BsaBI GATNNNNATC 1 cut(s) 357
BsaJI CCNNGG 1 cut(s) 376
Bsc4I CCNNNNNNNGG 2 cut(s) 40, 205
Bse1I ACTGG 1 cut(s) 97
Bse8I GATNNNNATC 1 cut(s) 357
BseBI CCWGG 1 cut(s) 377
BseDI CCNNGG 1 cut(s) 376
BseGI GGATG 1 cut(s) 293
BseJI GATNNNNATC 1 cut(s) 357
BseLI CCNNNNNNNGG 2 cut(s) 40, 205
BseNI ACTGG 1 cut(s) 97
BshFI GGCC 5 cut(s) 33, 178, 214, 243, 375
BslFI GGGAC 1 cut(s) 125
BslI CCNNNNNNNGG 2 cut(s) 40, 205
BsmAI GTCTC 1 cut(s) 160
BsmFI GGGAC 1 cut(s) 125
BsnI GGCC 5 cut(s) 33, 178, 214, 243, 375
Bsp119I TTCGAA 1 cut(s) 61
Bsp143I GATC 2 cut(s) 257, 358
BspANI GGCC 5 cut(s) 33, 178, 214, 243, 375
BspPI GGATC 1 cut(s) 265
BspT104I TTCGAA 1 cut(s) 61
BsrI ACTGG 1 cut(s) 97
BssECI CCNNGG 1 cut(s) 376
BssMI GATC 2 cut(s) 257, 358
Bst2UI CCWGG 1 cut(s) 377
Bst4CI ACNGT 1 cut(s) 139
BstBI TTCGAA 1 cut(s) 61
BstC8I GCNNGC 1 cut(s) 373
BstENI CCTNNNNNAGG 1 cut(s) 38
BstF5I GGATG 1 cut(s) 293
BstKTI GATC 2 cut(s) 260, 361
BstMAI GTCTC 1 cut(s) 160
BstMBI GATC 2 cut(s) 257, 358
BstNI CCWGG 1 cut(s) 377
BstSCI CCNGG 1 cut(s) 375
BstX2I RGATCY 1 cut(s) 257
BstYI RGATCY 1 cut(s) 257
BsuRI GGCC 5 cut(s) 33, 178, 214, 243, 375
BtsCI GGATG 1 cut(s) 293
Cac8I GCNNGC 1 cut(s) 373
Cfr13I GGNCC 1 cut(s) 212
CviAII CATG 3 cut(s) 174, 216, 245
CviJI RGCY 7 cut(s) 33, 100, 178, 214, 243, 308, 375
CviKI_1 RGCY 7 cut(s) 33, 100, 178, 214, 243, 308, 375
DpnI GATC 2 cut(s) 259, 360
DpnII GATC 2 cut(s) 257, 358
EaeI YGGCCR 1 cut(s) 241
Eco147I AGGCCT 1 cut(s) 33
EcoNI CCTNNNNNAGG 1 cut(s) 38
EcoRII CCWGG 1 cut(s) 375
FaeI CATG 3 cut(s) 177, 219, 248
FaiI YATR 6 cut(s) 159, 175, 182, 217, 246, 265
FaqI GGGAC 1 cut(s) 125
FatI CATG 3 cut(s) 173, 215, 244
FokI GGATG 1 cut(s) 300
GsuI CTGGAG 2 cut(s) 140, 171
HaeIII GGCC 5 cut(s) 33, 178, 214, 243, 375
Hin1II CATG 3 cut(s) 177, 219, 248
HinfI GANTC 2 cut(s) 124, 314
HphI GGTGA 4 cut(s) 107, 188, 323, 355
Hpy188I TCNGA 3 cut(s) 10, 112, 134
Hpy188III TCNNGA 3 cut(s) 119, 188, 274
HpyAV CCTTC 4 cut(s) 92, 203, 242, 248
HpyCH4III ACNGT 1 cut(s) 139
HpyCH4V TGCA 3 cut(s) 105, 173, 371
Hsp92II CATG 3 cut(s) 177, 219, 248
Kzo9I GATC 2 cut(s) 257, 358
LpnPI CCDG 7 cut(s) 78, 104, 201, 282, 294, 357, 362
LweI GCATC 1 cut(s) 358
MalI GATC 2 cut(s) 259, 360
MboI GATC 2 cut(s) 257, 358
MflI RGATCY 1 cut(s) 257
MluCI AATT 4 cut(s) 24, 57, 161, 192
MnlI CCTC 2 cut(s) 34, 145
MseI TTAA 1 cut(s) 51
MslI CAYNNNNRTG 1 cut(s) 286
MspR9I CCNGG 1 cut(s) 377
MvaI CCWGG 1 cut(s) 377
NdeII GATC 2 cut(s) 257, 358
NlaIII CATG 3 cut(s) 177, 219, 248
NspV TTCGAA 1 cut(s) 61
PceI AGGCCT 1 cut(s) 33
PfeI GAWTC 2 cut(s) 124, 314
Psp6I CCWGG 1 cut(s) 375
PspGI CCWGG 1 cut(s) 375
PspPI GGNCC 1 cut(s) 212
PsuI RGATCY 1 cut(s) 257
RseI CAYNNNNRTG 1 cut(s) 286
SaqAI TTAA 1 cut(s) 51
Sau3AI GATC 2 cut(s) 257, 358
Sau96I GGNCC 1 cut(s) 212
ScrFI CCNGG 1 cut(s) 377
SetI ASST 2 cut(s) 224, 301
SfaNI GCATC 1 cut(s) 358
SfuI TTCGAA 1 cut(s) 61
SmiMI CAYNNNNRTG 1 cut(s) 286
Sse9I AATT 4 cut(s) 24, 57, 161, 192
SseBI AGGCCT 1 cut(s) 33
StuI AGGCCT 1 cut(s) 33
StyD4I CCNGG 1 cut(s) 375
TaaI ACNGT 1 cut(s) 139
TaqI TCGA 1 cut(s) 61
TaqII GACCGA 1 cut(s) 87
TasI AATT 4 cut(s) 24, 57, 161, 192
TfiI GAWTC 2 cut(s) 124, 314
Tru1I TTAA 1 cut(s) 51
Tru9I TTAA 1 cut(s) 51
TspDTI ATGAA 1 cut(s) 261
XagI CCTNNNNNAGG 1 cut(s) 38
XapI RAATTY 3 cut(s) 24, 57, 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.