Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001742.1

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 692

Gene Structure 692 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 423 bp

gctctcacttatggctttggttttgccacaatcgcttccaccctcacacatgtagggttattctatggaagagagatcatggatcgctatcgtgcttcttaccaaggaaaggatgacatccatactagattgatgagaaaatacaaggacataccttcctggtggttttacgtgttgctctccgttacagttgcagtttcccttgtactttgcatcttcttgaatgatcaggttcagatgccatggtggggacttctatttgctagtgccttagcctttacattcacccttcctatcagcataataacagcaacaacaaaccagacaccaggactaaacataataacagagtacatcatgggaatcatattaccaggaagaccaatagccaatgtatgcttttgtctgatgacctttttgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005215 GO:0005575 GO:0005623 GO:0005886 GO:0005887 GO:0006810 GO:0006857 GO:0008150 GO:0009628 GO:0015833 GO:0016020 GO:0016021 GO:0022857 GO:0031224 GO:0031226 GO:0035672 GO:0035673 GO:0042886 GO:0042887 GO:0044425 GO:0044459 GO:0044464 GO:0050896 GO:0051179 GO:0051234 GO:0055085 GO:0071702 GO:0071705 GO:0071944 GO:0080167 GO:1904680

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

OPT

Protein Analysis

140

Amino Acids

15.87

Weight (kDa)

8.54

Isoelectric Point (pI)

24.0

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
OPT	PF03169	1 - 138	5.2e-36	OPT oligopeptide transporter protein

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	90
AfaI	GTAC	2 cut(s)	207, 353
AfiI	CCNNNNNNNGG	2 cut(s)	109, 248
AflIII	ACRYGT	2 cut(s)	49, 171
AgsI	TTSAA	1 cut(s)	223
AjnI	CCWGG	3 cut(s)	158, 328, 373
AlwI	GGATC	1 cut(s)	90
AsuHPI	GGTGA	1 cut(s)	277
BbsI	GAAGAC	1 cut(s)	385
BciT130I	CCWGG	3 cut(s)	160, 330, 375
BclI	TGATCA	1 cut(s)	226
BfaI	CTAG	2 cut(s)	126, 264
Bme1390I	CCNGG	3 cut(s)	160, 330, 375
BmrFI	CCNGG	3 cut(s)	160, 330, 375
BmsI	GCATC	2 cut(s)	222, 228
BpiI	GAAGAC	1 cut(s)	385
Bpu10I	CCTNAGC	1 cut(s)	271
BsaAI	YACGTR	1 cut(s)	172
BsaBI	GATNNNNATC	1 cut(s)	87
BsaJI	CCNNGG	2 cut(s)	103, 242
Bsc4I	CCNNNNNNNGG	2 cut(s)	109, 248
Bse8I	GATNNNNATC	1 cut(s)	87
BseBI	CCWGG	3 cut(s)	160, 330, 375
BseDI	CCNNGG	2 cut(s)	103, 242
BseGI	GGATG	2 cut(s)	117, 118
BseJI	GATNNNNATC	1 cut(s)	87
BseLI	CCNNNNNNNGG	2 cut(s)	109, 248
BslFI	GGGAC	1 cut(s)	264
BslI	CCNNNNNNNGG	2 cut(s)	109, 248
BsmFI	GGGAC	1 cut(s)	264
Bsp143I	GATC	3 cut(s)	75, 82, 226
Bsp19I	CCATGG	1 cut(s)	242
BspPI	GGATC	1 cut(s)	90
BssECI	CCNNGG	2 cut(s)	103, 242
BssMI	GATC	3 cut(s)	75, 82, 226
BssT1I	CCWWGG	2 cut(s)	103, 242
Bst2UI	CCWGG	3 cut(s)	160, 330, 375
Bst4CI	ACNGT	1 cut(s)	190
Bst6I	CTCTTC	1 cut(s)	64
BstBAI	YACGTR	1 cut(s)	172
BstDEI	CTNAG	1 cut(s)	271
BstDSI	CCRYGG	1 cut(s)	242
BstF5I	GGATG	2 cut(s)	117, 118
BstKTI	GATC	3 cut(s)	78, 85, 229
BstMBI	GATC	3 cut(s)	75, 82, 226
BstMWI	GCNNNNNNNGC	1 cut(s)	32
BstNI	CCWGG	3 cut(s)	160, 330, 375
BstNSI	RCATGY	1 cut(s)	53
BstSCI	CCNGG	3 cut(s)	158, 328, 373
BstV2I	GAAGAC	1 cut(s)	385
BtgI	CCRYGG	1 cut(s)	242
BtsCI	GGATG	2 cut(s)	117, 118
Csp6I	GTAC	2 cut(s)	206, 352
CviAII	CATG	4 cut(s)	50, 79, 243, 358
CviJI	RGCY	3 cut(s)	15, 275, 389
CviKI_1	RGCY	3 cut(s)	15, 275, 389
CviQI	GTAC	2 cut(s)	206, 352
DdeI	CTNAG	1 cut(s)	271
DpnI	GATC	3 cut(s)	77, 84, 228
DpnII	GATC	3 cut(s)	75, 82, 226
Eam1104I	CTCTTC	1 cut(s)	64
EarI	CTCTTC	1 cut(s)	64
Eco130I	CCWWGG	2 cut(s)	103, 242
EcoRII	CCWGG	3 cut(s)	158, 328, 373
EcoT14I	CCWWGG	2 cut(s)	103, 242
ErhI	CCWWGG	2 cut(s)	103, 242
FaeI	CATG	4 cut(s)	53, 82, 246, 361
FaqI	GGGAC	1 cut(s)	264
FatI	CATG	4 cut(s)	49, 78, 242, 357
FbaI	TGATCA	1 cut(s)	226
FokI	GGATG	2 cut(s)	104, 125
FspBI	CTAG	2 cut(s)	126, 264
Hin1II	CATG	4 cut(s)	53, 82, 246, 361
HinfI	GANTC	1 cut(s)	363
HphI	GGTGA	1 cut(s)	277
Hpy188I	TCNGA	2 cut(s)	237, 408
Hpy188III	TCNNGA	1 cut(s)	220
HpyAV	CCTTC	2 cut(s)	165, 299
HpyCH4III	ACNGT	1 cut(s)	190
HpyCH4IV	ACGT	1 cut(s)	171
HpyCH4V	TGCA	2 cut(s)	194, 213
HpyF10VI	GCNNNNNNNGC	1 cut(s)	32
HpyF3I	CTNAG	1 cut(s)	271
HpySE526I	ACGT	1 cut(s)	171
Hsp92II	CATG	4 cut(s)	53, 82, 246, 361
Ksp22I	TGATCA	1 cut(s)	226
Kzo9I	GATC	3 cut(s)	75, 82, 226
LpnPI	CCDG	8 cut(s)	145, 172, 215, 315, 335, 342, 360, 387
LweI	GCATC	2 cut(s)	222, 228
MaeI	CTAG	2 cut(s)	126, 264
MaeII	ACGT	1 cut(s)	171
MaeIII	GTNAC	1 cut(s)	184
MalI	GATC	3 cut(s)	77, 84, 228
MboI	GATC	3 cut(s)	75, 82, 226
MboII	GAAGA	3 cut(s)	81, 208, 390
MnlI	CCTC	1 cut(s)	53
MspR9I	CCNGG	3 cut(s)	160, 330, 375
MvaI	CCWGG	3 cut(s)	160, 330, 375
MwoI	GCNNNNNNNGC	1 cut(s)	32
NcoI	CCATGG	1 cut(s)	242
NdeII	GATC	3 cut(s)	75, 82, 226
NlaIII	CATG	4 cut(s)	53, 82, 246, 361
NspI	RCATGY	1 cut(s)	53
PciI	ACATGT	1 cut(s)	49
PfeI	GAWTC	1 cut(s)	363
Ppu21I	YACGTR	1 cut(s)	172
PscI	ACATGT	1 cut(s)	49
Psp6I	CCWGG	3 cut(s)	158, 328, 373
PspGI	CCWGG	3 cut(s)	158, 328, 373
RsaI	GTAC	2 cut(s)	207, 353
RsaNI	GTAC	2 cut(s)	206, 352
Sau3AI	GATC	3 cut(s)	75, 82, 226
ScrFI	CCNGG	3 cut(s)	160, 330, 375
SetI	ASST	4 cut(s)	157, 174, 234, 416
SfaNI	GCATC	2 cut(s)	222, 228
SspMI	CTAG	2 cut(s)	126, 264
StyD4I	CCNGG	3 cut(s)	158, 328, 373
StyI	CCWWGG	2 cut(s)	103, 242
TaaI	ACNGT	1 cut(s)	190
TaiI	ACGT	1 cut(s)	174
TatI	WGTACW	2 cut(s)	205, 351
TfiI	GAWTC	1 cut(s)	363
TspGWI	ACGGA	1 cut(s)	172
XceI	RCATGY	1 cut(s)	53
XspI	CTAG	2 cut(s)	126, 264

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.