Rmu_sc0001742.1_g000006

Plant protein of unknown function

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001742.1
N/A
Physical Location & Seq
Forward (+)
19006 .. 19551
546 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 546 bp
ctggaagcagctcaaggatggccggaaccttaccgattacaacatccaaaaggaatcgatcctccgtctccgaggaggtatgcagatcttcgtcaaaaccccaaaataaagagggcaaattattatgtcggattggctctcggcttcaacattaaaactgtcataactctaggcttcattgaagtccctagtgttgagaggctttccatacagtttctttatcaggactcaggagttttcagttggtggcacaactttcgggggaacgtcattagaggagttatcgaagtgcaacaccttgttgatctcttaagaaagctatggatagctcctttatcgaaagaaccatccatgaccaaacaaagaaaatctgcaatagcacctggcattgaaaagctacacctggcaggagtcaaatttaaggtcaaatcagacatgaacttgtttgacatacgattcgataaagggattctaaagattccaagattgaatataggtgaaattgcagaaacagaattaccgagcctaatgggatgttgtcagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF247

Protein Analysis

181

Amino Acids

20.65

Weight (kDa)

9.69

Isoelectric Point (pI)

45.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF247 PF03140 92 - 171 8.4e-12 Plant protein of unknown function
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 53
AcoI YGGCCR 1 cut(s) 20
AcsI RAATTY 1 cut(s) 416
AflII CTTAAG 1 cut(s) 310
AgsI TTSAA 4 cut(s) 148, 182, 392, 490
AjnI CCWGG 2 cut(s) 382, 402
AluBI AGCT 4 cut(s) 11, 319, 329, 397
AluI AGCT 4 cut(s) 11, 319, 329, 397
Alw26I GTCTC 1 cut(s) 72
AlwI GGATC 1 cut(s) 53
AoxI GGCC 1 cut(s) 20
ApeKI GCWGC 1 cut(s) 8
ApoI RAATTY 1 cut(s) 416
ArsI GACNNNNNNTTYG 4 cut(s) 408, 440, 440, 472
AsuHPI GGTGA 1 cut(s) 509
BbvI GCAGC 1 cut(s) 20
BccI CCATC 2 cut(s) 12, 355
BcgI CGANNNNNNTGC 2 cut(s) 239, 273
BciT130I CCWGG 2 cut(s) 384, 404
BcoDI GTCTC 1 cut(s) 72
BfaI CTAG 2 cut(s) 170, 189
BfrI CTTAAG 1 cut(s) 310
BglII AGATCT 1 cut(s) 85
BisI GCNGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 10
Bme1390I CCNGG 2 cut(s) 384, 404
BmiI GGNNCC 1 cut(s) 27
BmrFI CCNGG 2 cut(s) 384, 404
Bsa29I ATCGAT 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 71
BseBI CCWGG 2 cut(s) 384, 404
BseCI ATCGAT 1 cut(s) 57
BseDI CCNNGG 1 cut(s) 71
BseGI GGATG 4 cut(s) 23, 43, 347, 539
BseMII CTCAG 1 cut(s) 243
BseRI GAGGAG 2 cut(s) 88, 291
BseXI GCAGC 1 cut(s) 20
BshFI GGCC 1 cut(s) 22
BshVI ATCGAT 1 cut(s) 57
BsiSI CCGG 1 cut(s) 23
BslFI GGGAC 1 cut(s) 170
BsmAI GTCTC 1 cut(s) 72
BsmBI CGTCTC 1 cut(s) 72
BsmFI GGGAC 1 cut(s) 170
BsnI GGCC 1 cut(s) 22
Bsp143I GATC 3 cut(s) 58, 85, 304
BspANI GGCC 1 cut(s) 22
BspCNI CTCAG 1 cut(s) 242
BspDI ATCGAT 1 cut(s) 57
BspLI GGNNCC 1 cut(s) 27
BspPI GGATC 1 cut(s) 53
BspTI CTTAAG 1 cut(s) 310
BssECI CCNNGG 1 cut(s) 71
BssMI GATC 3 cut(s) 58, 85, 304
Bst2UI CCWGG 2 cut(s) 384, 404
Bst4CI ACNGT 2 cut(s) 160, 213
BstAFI CTTAAG 1 cut(s) 310
BstDEI CTNAG 1 cut(s) 229
BstF5I GGATG 4 cut(s) 23, 43, 347, 539
BstKTI GATC 3 cut(s) 61, 88, 307
BstMAI GTCTC 1 cut(s) 72
BstMBI GATC 3 cut(s) 58, 85, 304
BstNI CCWGG 2 cut(s) 384, 404
BstSCI CCNGG 2 cut(s) 382, 402
BstV1I GCAGC 1 cut(s) 20
BstX2I RGATCY 1 cut(s) 85
BstYI RGATCY 1 cut(s) 85
Bsu15I ATCGAT 1 cut(s) 57
BsuRI GGCC 1 cut(s) 22
BsuTUI ATCGAT 1 cut(s) 57
BtsCI GGATG 4 cut(s) 23, 43, 347, 539
ClaI ATCGAT 1 cut(s) 57
CviAII CATG 2 cut(s) 352, 436
DdeI CTNAG 1 cut(s) 229
DpnI GATC 3 cut(s) 60, 87, 306
DpnII GATC 3 cut(s) 58, 85, 304
EaeI YGGCCR 1 cut(s) 20
EcoRII CCWGG 2 cut(s) 382, 402
Esp3I CGTCTC 1 cut(s) 72
FaeI CATG 2 cut(s) 355, 439
FaiI YATR 9 cut(s) 81, 126, 164, 209, 322, 353, 437, 452, 494
FaqI GGGAC 1 cut(s) 170
FatI CATG 2 cut(s) 351, 435
Fnu4HI GCNGC 1 cut(s) 9
FokI GGATG 3 cut(s) 30, 30, 334
Fsp4HI GCNGC 1 cut(s) 9
FspBI CTAG 2 cut(s) 170, 189
GluI GCNGC 1 cut(s) 9
HaeIII GGCC 1 cut(s) 22
HapII CCGG 1 cut(s) 23
Hin1II CATG 2 cut(s) 355, 439
HinfI GANTC 6 cut(s) 54, 227, 411, 456, 469, 478
HpaII CCGG 1 cut(s) 23
HphI GGTGA 1 cut(s) 509
Hpy188I TCNGA 3 cut(s) 72, 131, 433
Hpy188III TCNNGA 2 cut(s) 224, 231
HpyCH4III ACNGT 2 cut(s) 160, 213
HpyCH4IV ACGT 1 cut(s) 267
HpyCH4V TGCA 4 cut(s) 83, 292, 374, 506
HpyF3I CTNAG 1 cut(s) 229
HpySE526I ACGT 1 cut(s) 267
Hsp92II CATG 2 cut(s) 355, 439
Kzo9I GATC 3 cut(s) 58, 85, 304
LmnI GCTCC 1 cut(s) 334
LpnPI CCDG 8 cut(s) 36, 209, 216, 369, 389, 393, 396, 416
Lsp1109I GCAGC 1 cut(s) 20
MaeI CTAG 2 cut(s) 170, 189
MaeII ACGT 1 cut(s) 267
MalI GATC 3 cut(s) 60, 87, 306
MboI GATC 3 cut(s) 58, 85, 304
MboII GAAGA 1 cut(s) 80
MflI RGATCY 1 cut(s) 85
MluCI AATT 4 cut(s) 118, 416, 501, 515
MlyI GAGTC 2 cut(s) 221, 420
MmeI TCCRAC 1 cut(s) 109
MnlI CCTC 6 cut(s) 66, 69, 72, 105, 192, 269
MseI TTAA 3 cut(s) 153, 311, 420
MspCI CTTAAG 1 cut(s) 310
MspI CCGG 1 cut(s) 23
MspR9I CCNGG 2 cut(s) 384, 404
MvaI CCWGG 2 cut(s) 384, 404
NdeII GATC 3 cut(s) 58, 85, 304
NlaIII CATG 2 cut(s) 355, 439
NlaIV GGNNCC 1 cut(s) 27
NmeAIII GCCGAG 1 cut(s) 120
PfeI GAWTC 4 cut(s) 54, 456, 469, 478
PkrI GCNGC 1 cut(s) 10
PleI GAGTC 2 cut(s) 221, 419
PpsI GAGTC 2 cut(s) 221, 419
Psp6I CCWGG 2 cut(s) 382, 402
PspGI CCWGG 2 cut(s) 382, 402
PspN4I GGNNCC 1 cut(s) 27
PsuI RGATCY 1 cut(s) 85
SaqAI TTAA 3 cut(s) 153, 311, 420
SatI GCNGC 1 cut(s) 9
Sau3AI GATC 3 cut(s) 58, 85, 304
SchI GAGTC 2 cut(s) 221, 420
ScrFI CCNGG 2 cut(s) 384, 404
SmlI CTYRAG 2 cut(s) 12, 310
SmoI CTYRAG 2 cut(s) 12, 310
Sse9I AATT 4 cut(s) 118, 416, 501, 515
SspMI CTAG 2 cut(s) 170, 189
StyD4I CCNGG 2 cut(s) 382, 402
TaaI ACNGT 2 cut(s) 160, 213
TaiI ACGT 1 cut(s) 270
TaqI TCGA 4 cut(s) 57, 285, 338, 459
TasI AATT 4 cut(s) 118, 416, 501, 515
TfiI GAWTC 4 cut(s) 54, 456, 469, 478
Tru1I TTAA 3 cut(s) 153, 311, 420
Tru9I TTAA 3 cut(s) 153, 311, 420
TseI GCWGC 1 cut(s) 8
TspDTI ATGAA 2 cut(s) 166, 452
TspGWI ACGGA 1 cut(s) 54
Vha464I CTTAAG 1 cut(s) 310
XapI RAATTY 1 cut(s) 416
XspI CTAG 2 cut(s) 170, 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.